Home | Current Issue | Past Issues | Search | CollectionsRSS | PDA Services | FAQ | SHCIM Online | Chinese Updated Friday, November 24, 2017
 How to Show Chinese in English Operating System
Original Experimental Research
Journal of Chinese Integrative Medicine: Volume 9   August, 2011   Number 8

DOI: 10.3736/jcim20110813
Analysis of the capability of ultra-highly diluted glucose to increase glucose uptake in arsenite-stressed bacteria Escherichia coli
1. Anisur Rahman Khuda-Bukhsh (Cytogenetics and Molecular Biology Laboratory, Department of Zoology, University of Kalyani, Kalyani 741235, India E-mail: prof_arkb@yahoo.co.in, khudabukhsh_48@rediffmail.com)
2. Arnab De (Cytogenetics and Molecular Biology Laboratory, Department of Zoology, University of Kalyani, Kalyani 741235, India )
3. Durba Das (Cytogenetics and Molecular Biology Laboratory, Department of Zoology, University of Kalyani, Kalyani 741235, India )
4. Suman Dutta (Cytogenetics and Molecular Biology Laboratory, Department of Zoology, University of Kalyani, Kalyani 741235, India )
5. Naoual Boujedaini (Boiron Laboratory, Lyon, France )

Objective: Whether ultra-highly diluted homeopathic remedies can affect living systems is questionable. Therefore, this study sees value in the analysis of whether homeopathically diluted glucose 30C has any effect on Escherichia coli exposed to arsenite stress.
Methods: E. coli were cultured to their log phase in standard Luria-Bertani medium and then treated with either 1 mmol/L or 2 mmol/L sodium arsenite, with or without supplementation of either 1% or 3% glucose, an ultra-highly diluted and agitated ethanolic solution (70%) of glucose (diluted 1060 times), glucose 30C or 70% ethanol (placebo) in the medium. Glucose uptake, specific activities of hexokinase and glucokinase, membrane potential, intracellular adenosine triphosphate (ATP) and expression of glucose permease in E. coli were analyzed at two different time intervals. Arsenic content in E. coli (intracellular) and in the spent medium (extracellular) was also determined.
Results: In arsenite-exposed E. coli, the glucose uptake increased along with decreases in the specific activities of hexokinase and glucokinase, intracellular ATP and membrane potential and an increase in the gene expression level of glucose permease. Glucose uptake increased further by addition of 1%, 3% or ultra-highly diluted glucose in the medium, but not by the placebo.
Conclusion: The results demonstrated the efficacy of the ultra-highly diluted and agitated glucose in mimicking the action of actual glucose supplementation and its ability to modulate expressions of hexokinase and glucokinase enzymes and glucose permease genes, thereby validating the efficacy of ultra-high dilutions used in homeopathy.

JCIM
Open Access
THIS ARTICLE
-  Abstract
-  Full text
-  Download PDF file
-  Send to a friend
-  Related articles in JCIM
-  Cited in JCIM
-  Reader's comments
-  Send a comment

Received February 25, 2011; accepted April 21, 2011; published online August 15, 2011.
Full-text LinkOut at PubMed. Journal title in PubMed: Zhong Xi Yi Jie He Xue Bao.

Correspondence: Anisur Rahman Khuda-Bukhsh, PhD, Professor; Tel: +91-33-25828750-315, +91-33-25828768; E-mail: prof_arkb@yahoo.co.in, khudabukhsh_48@rediffmail.com

Jump to Section
-  Top
-  Article & Author Info
-  Introduction
-  Materials and methods
-  Results
-  Discussion
-  Acknowledgements
-  Competing interests
-  References
  

     Homeopathy is an alternative method of treatment that often uses ultra-highly diluted medicines. The homeopathic method of dilution (potentiation) involves agitations (jerks or succussions) of the original drug in the ethanol vehicle (generally 40% to 90% ethanol) in each step of dilution. In the centesimal scale, 1 mL of the original drug (mother tincture) is mixed with 99 mL of ethanol and given 10 jerks to achieve a potency of 1C of the drug; again 99 mL of ethanol is mixed with 1 mL of the potency 1C and given 10 jerks to achieve a potency of 2C, and so on. Therefore, when the drug attains potency 12C and above, it becomes diluted to 10-24 (beyond Avogadro’s limit) or above and the existence of even a single molecule of the original drug substance in such high potencies becomes highly improbable. Herein lays the controversy as to whether dilutions beyond Avogadro’s limit can have any effect on living systems.
     Although homeopathic clinicians and practitioners strongly believe that these diluted drugs can act to remove disease symptoms and cure patients of their conditions, others do not accept that any ultra-highly diluted drug can have demonstrable effects on any living system and question the scientific founding for the efficacy of such diluted drugs in ameliorating or curing any disease1-5. Furthermore, in some dubious cases, the reported effects could possibly be due to the so-called “placebo effects”.
     Numerous early attempts have been made to prove the efficacy of ultra-highly diluted homeopathic remedies, but most have not been accepted due to some lacunae in experimental design or for methodological shortcomings, or for some other flaws in the reports3-5. However, Khuda-Bukhsh et al6-9 proposed a gene-regulatory hypothesis to explain the possible molecular mechanism of action of potentized homeopathic drugs with many circumstantial evidence to support their claim; this also needs to be further validated.
     The present experiment was conducted to test primarily the hypothesis that a homeopathically potentized glucose diluted 1060 times (henceforth referred to as glucose 30C), far above the Avogadro’s limit, could modulate metabolic activities in one of the prokaryotic organisms, Escherichia coli, under toxic stress. Furthermore, attempts were also made to understand the possible mechanisms involved. E. coli, commensal of the gut of warm-blooded animals and humans, can cause severe extra-intestinal diseases, such as septicemia and urinary tract infections10. Therefore, E. coli could be a suitable model prokaryotic organism with a simple genetic system for testing if an ultra-highly diluted homeopathically potentized solution of glucose (glucose 30C) could produce demonstrable effects in relation to glucose metabolism in this bacteria under some kind of physical stress such as simulating toxicity or disease stress.
     Arsenic is a toxic metalloid widely disseminated in the environment and causes a variety of health and environment hazards. Due to the widespread occurrence of arsenic in the environment, every organism, from E. coli to human, has mechanisms for arsenic detoxification11. In bacteria, the genes for arsenic detoxification are usually encoded by arsenic resistance (ars) operons12, 13. Ars operon has three genes, arsR, arsB and arsC, where arsR is an arsenic (Ⅲ)-responsive transcriptional repressor14. The arsenic pump localized in the inner membrane of E. coli is composed of two types of subunits, the 45-kD ArsB protein15, 16 and the 63-kD ArsA protein17. Dey et al18 demonstrated that the ArsAB adenosine triphosphatase (ATPase) complex is a functional arsenite pump in vitro.
     During glycolysis, arsenic inhibits the function of phosphoglyceral kinase in the glycolysis pathway. Therefore, on arsenic exposure, the glycolytic pathway remains incompletely utilized for the ultimate formation of adenosine triphosphate (ATP), producing 4 mol instead of 8 mol of ATP (from 1 mol of glucose) produced by the normal pathway19. As the arsenic pump of the bacteria can only extrude arsenic at the expense of energy, by breakdown of ATP to adenosine diphosphate (ADP), and because on exposure to arsenic the ATP synthesis through glycolytic pathway is reduced to half, the first line of activity that would be expected in E. coli would be to increase glucose uptake (the ready source of energy) from the growth medium.
     Hence, this study made glucose uptake an important parameter for the study and tested the efficacy of homeopathically prepared ultra-highly diluted glucose 30C (serially diluted 1060 times with agitations) on E. coli exposed to arsenite stress. The selection of glucose 30C as a possible remedy gains further significance because it is based on one of the homeopathic doctrines, namely, “like cures like”, that is, glucose 30C could possibly have ameliorative effects on glucose metabolism-related toxicity or stress.

 
  

1  Materials and methods
1.1Culture and treatment groups of E. coli  E. coli were cultured to their log phase in the standard Luria-Bertani (LB) medium and were allocated randomly to the following sets: (1) standard LB medium — normal control; (2) LB supplemented with 1% and 3% glucose, respectively — glucose-supplemented control; (3) LB plus glucose 30C (in 70% alcohol) — glucose 30C-supplemented control; (4) LB plus 1 mmol/L sodium arsenite (Ⅲ) (Fluka, Switzerland) — arsenite-treated 1; (5) LB plus 2 mmol/L sodium arsenite — arsenite treated-2; (6) LB plus 1 mmol/L arsenite plus glucose 30C — arsenite-treated glucose 30C-supplemented 1; (7) LB plus 2 mmol/L arsenite plus glucose 30C — arsenite treated glucose 30C-supplemented 2; (8) LB plus 1 mmol/L arsenite plus alcohol 30C — arsenite-treated placebo-administered positive control 1; (9) LB plus 2 mmol/L arsenite plus alcohol 30C — arsenite-treated placebo-administered positive control 2.
     From the growth curve (Figure 1), 1 mmol/L and 2 mmol/L sodium arsenite were chosen as sub-lethal doses in the experiments. From the control curve (where no arsenite was added) it was clear that the organism retained its log phase up to 1.5 h (90 min); hence all the experiments were performed at 45 min and 90 min.

 

Figure 1  E. coli growth curve under different doses of sodium arsenite


     The different parameters of study mentioned below have been conducted on three sub-sets of experiments each and for each sub-set of experiment, three replicates were studied (n=9). For normalization of the data against a standard growth pattern of the bacteria, the mean values were produced.
1.2  Selection of the dose of sodium arsenite  E. coli were cultured to their log phase and then different doses of sodium arsenite (0 to 3.5 mmol/L) were administered in their growing medium and the optical density was measured at 600 nm wavelength under different time intervals.
1.3  Glucose uptake measurement  Glucose uptake in E. coli of different sets was quantified by Anthron’s method20 (spectrophotometric analysis by Shimadzu PharmaSpec UV-1700) at 45 min and 90 min, respectively.
1.4  Hexokinase assay  The specific activity of hexokinase21 in E. coli of different sets was quantified by spectrophotometric study at 45 min and 90 min, respectively.
1.5  Glucokinase assay  The specific activity of glucokinase22 in E. coli of different sets was quantified by spectrophotometric study at 45 min and 90 min, respectively.
1.6  Total ATP measurement  Total ATP contents in E. coli of different sets were measured by luminometric study23, 24 at 45 min and 90 min, respectively, by using Thermo-Scientific Varioskan by EnzyLight ATP Assay Kit.
1.7  Measurement of membrane potential by spectrofluorimetric method  Membrane potential of E. coli was determined spectrofluorimetrically by measuring the fluorescence quenching in intact cells25 using the fluorescence dye 3,3′-diphenylthiocarbocyanine iodide. The incorporation of the dye into the intact cell membrane was known to be potential-dependent26. Relative membrane potential was calculated at 45 min and 90 min after the addition of arsenite by using the following equation: (1-(b-a)/(c-a))×100% (a=fluorescence intensity, b=fluorescence intensity with (cells+dye); c=fluorescence intensity with (cells+dye+carbonyl cyanide m-chlorophenylhydrazone (CCCP)).
1.8  Measurement of membrane potential by flow-cytometry method  The change of membrane potential of the experimental cells was also analysed qualitatively by a flow-cytometer (FACS Calibur, Becton Dickson)27. Cells were cultured to their log phase and the membrane potential was measured by a flow-cytometer using the same dye (fluorescence dye 3,3’-diphenylthiocarbocyanine iodide) after the addition of 1 mmol/L or 2 mmol/L sodium arsenite.
1.9  RNA isolation, cDNA preparation and gene level expression study by reverse transcription-polymerase chain reaction  Total RNA was isolated from E. coli cells using TRIzol reagent (Bangalore Genei, India)28. Polymerase chain reaction (PCR) was performed using Taq DNA polymerase (Chromous Biotech, India) in accordance with the manufacturer’s instruction. The primer sequences of amplified genes are shown in Table 1. PCR was performed on an automated thermal cycler (Applied Biosystems, USA). Amplified cDNA products were separated on 1.0% agarose gel electrophoresis in tris-acetic acid-ethylene diamine tetraacetic acid (TAE) buffer with 0.5 μg/mL ethidium bromide, observed under an ultraviolet trans-illuminator and photographed. Densitometry was performed on a negative image using the TotalLab software.
 

Table 1  Primer sequences used for this study

Primer name

Primer sequences (5′-3′)

G-3-PDH (house-keeping gene)

Forward: CCCACTAACATCAAATGGGG

Reverse: CCTTCCACAATGCAAAGTT

ptsG (glucose permease)

Forward: CGGCGCTGACCTGGTTCCTG

Reverse: ACGGAACCGCCTGCTTCTGC


1.10  Quantitative real-time reverse transcription-PCR  Total RNA was isolated from E. coli cells using TRIzol reagent (Bangalore Genei, India), and after preparing cDNA a quantitative PCR was performed with SYBR Green Master Mix using an ABI7500 (Applied Biosystems, Inc., Foster City, CA, USA)29. Specific primers for glucose permease (ptsG F-5′-ACGCTTTGTGCCGATCATTTCTGG -3′ and ptsG R-5′-AACGCAACTACCGGGTTCTGGTAA-3′) and control house-keeping gene glyceraldehyde-3-phosphatedehydrogenase (G-3-PDH) (F-5′-GAGAACGGGAAGCTTGTCATC-3′ and R-5′-CATGACGAACATGGGGGCATC-3′) were used in this study. The relative gene expressions were normalized to G-3-PDH using the 2-ΔΔCT (ΔΔCT=ΔCT sample-ΔCT untreated control).
1.11  Arsenic measurement in spent medium and E. coli cells  Arsenic measurements30 in spent media and in E. coli cells of different sets were quantified by an atomic absorption spectroscope (AAS, Perkin-Elmer AA200, USA).
1.12  Preparation and source of glucose 30C and placebo 30C  The glucose 30C and placebo 30C (70% ethanol) were prepared by the procedure of homeopathic serial dilutions and agitations; 1 mL of 1% glucose dissolved in 70% ethyl alcohol (the initial drug substance) was diluted with 99 mL of 70% ethanol and the mixture was given 10 hand jerks to produce potency 1; 1 mL of potency 1 was again mixed with 99 mL of 70% ethanol and agitated similarly to produce potency 2 and so on. The glucose 30C and placebo 30C were procured from Boiron Laboratory, Lyon, France.
     The observers were blinded during observation and scoring of the data. The different coded vials (containing the randomized populations of E. coli) of both the experimental (containing the glucose 30C) and control sets (the placebo of vehicle) were not known to the observers as to which one belonged to the treated or control group; they were only deciphered later to remove any bias in observation.
1.13  Statistical analysis  Data are presented as mean±standard error of mean (SEM). Statistical analysis was performed by one-way analysis of variance and Dunnett-t test. P<0.05 was considered significant.

Jump to Section
-  Top
-  Article & Author Info
-  Introduction
-  Materials and methods
-  Results
-  Discussion
-  Acknowledgements
-  Competing interests
-  References
  

2  Results
2.1  Glucose uptake  The glucose uptakes (μg/mL per cell) in different control and treatment groups are summarized in Table 2.
 

Table 2  Results of glucose uptake analysis

(Mean±SEM, μg/mL per cell)

Group

n

Glucose uptake

45 min

90 min

Normal control

9

4.17±0.70

0.53±0.04

Normal control+1% glucose

9

114.50±4.50*

27.00±5.00*

Normal control+3% glucose

9

115.00±3.50*

29.50±2.00*

Normal control+placebo 30C

9

1.74±0.60

0.29±0.08

Normal control+glucose 30C

9

4.46±0.40*

0.62±0.07*

1 mmol/L arsenite

9

7.56±0.90*

2.87±0.50*

1 mmol/L arsenite+placebo 30C

9

7.47±1.00

2.90±0.59

1 mmol/L arsenite+glucose 30C

9

8.20±1.00

3.12±0.40

2 mmol/L arsenite

9

8.21±0.90*

3.10±0.25*

2 mmol/L arsenite+placebo 30C

9

8.12±1.00

2.98±0.50

2 mmol/L arsenite+glucose 30C

9

8.80±1.20

3.45±0.50

*P<0.05, vs normal control; P<0.05, vs placebo-treated positive control (1 mmol/L arsenite); P<0.05, vs placebo-treated positive control (2 mmol/L arsenite). SEM: standard error of mean.

     The glucose uptake by E. coli significantly increased both at 45 min (P<0.05) and 90 min (P<0.05) after addition of 1% or 3% glucose as compared to that of the normal control cells. However, there was an overall decrease in glucose uptake when the data were compared between the 45 min and 90 min groups. In 1 mmol/L sodium arsenite treatment group, there was a significant increase in glucose uptake both at 45 min (P<0.05) and 90 min (P<0.05) as compared to that of the control group. Glucose uptake further increased (P<0.05) when glucose 30C was added (in comparison with placebo-treated positive control group), but not when placebo was added. Almost the same results were observed when E. coli was exposed to 2 mmol/L sodium arsenite.
2.2  Hexokinase assay  The specific activity of hexokinase in E. coli significantly decreased both at 45 min (P<0.05) and 90 min (P<0.05) after the addition of 1 mmol/L or 2 mmol/L sodium arsenite (Table 3). Specific activity of hexokinase decreased by 0.003 μmol/(mg·min) in 2 mmol/L arsenite insult than that of 1 mmol/L arsenite.

 

Table 3  Specific activity of hexokinase

(Mean±SEM, μmol/(mg·min))

Group

n

Activity of hexokinase

45 min

90 min

Normal control

9

0.058±0.006

0.045±0.004

Normal control+glucose 30C

9

0.054±0.004*

0.036±0.002*

1 mmol/L arsenite

9

0.023±0.003*

0.021±0.001*

1 mmol/L arsenite+placebo 30C

9

0.020±0.004

0.020±0.003

1 mmol/L arsenite+glucose 30C

9

0.017±0.003

0.015±0.005

2 mmol/L arsenite

9

0.020±0.004*

0.017±0.002*

2 mmol/L arsenite+placebo 30C

9

0.020±0.002

0.016±0.002

2 mmol/L arsenite+glucose 30C

9

0.013±0.002

0.013±0.003

*P<0.05, vs normal control; P<0.05, vs placebo-treated positive control (1 mmol/L arsenite); P<0.05, vs placebo-treated positive control (2 mmol/L arsenite). SEM: standard error of mean.

     Addition of glucose 30C to 1 mmol/L and 2 mmol/L sodium arsenite-treated cells showed a significant decrease in their specific activity after 45 min (P<0.05) and 90 min (P<0.05), respectively, as compared to only 1 mmol/L and 2 mmol/L sodium arsenite treatments. Addition of glucose 30C to the normal medium also produced a decrease in specific activity as compared to that of the control set both at 45 min and 90 min. The addition of placebo did not make any significant difference in the specific activity of hexokinase in E. coli either at 45 min or 90 min.
2.3  Glucokinase assay  The specific activity of glucokinase in E. coli significantly decreased both at 45 min (P<0.05) and 90 min (P<0.05) after the addition of 1 mmol/L and 2 mmol/L sodium arsenite (Table 4). Specific activity of glucokinase decreased approximately 0.001 μmol/(mg·min) in 2 mmol/L arsenite insult than that of 1 mmol/L arsenite.

 

Table 4  Specific activity of glucokinase

(Mean±SEM, μmol/(mg·min))

Group

n

Activity of glucokinase

45 min

90 min

Normal control

9

0.068±0.005

0.042±0.005

Normal control+glucose 30C

9

0.060±0.002*

0.038±0.002*

1 mmol/L arsenite

9

0.009±0.001*

0.007±0.001*

1 mmol/L arsenite+placebo 30C

9

0.009±0.002

0.007±0.001

1 mmol/L arsenite+glucose 30C

9

0.008±0.002△

0.003±0.001△

2 mmol/L arsenite

9

0.009±0.002*

0.006±0.001*

2 mmol/L arsenite+placebo 30C

9

0.009±0.002

0.006±0.001

2 mmol/L arsenite+glucose 30C

9

0.007±0.001

0.003±0.002

*P<0.05, vs normal control; P<0.05, vs placebo-treated positive control (1 mmol/L arsenite); P<0.05, vs placebo-treated positive control (2 mmol/L arsenite). SEM: standard error of mean.

     Addition of glucose 30C to 1 mmol/L and 2 mmol/L sodium arsenite-treated cells showed a significant decrease in their specific activity after 45 min (P<0.05) and 90 min (P<0.05), respectively, as compared to only 1 mmol/L and 2 mmol/L sodium arsenite treatments. Addition of glucose 30C to the normal medium also produced a decrease in the specific activity as compared to that of control set both at 45 min (0.008 μmol/(mg·min)) and 90 min (0.004 μmol/(mg·min)) interval; however, the placebo did not.
2.4  Total ATP measurement in E. coli  The data of total ATP concentrations in E. coli cells significantly decreased both at 45 min (P<0.05) and 90 min (P<0.05) after addition of 1 mmol/L and 2 mmol/L sodium arsenite treatment (Table 5).

 

Table 5  Results of intracellular ATP measurement
(Mean±SEM, μmol/L per cell)

Group

n

ATP measurement

45 min

90 min

Normal control

9

4.750±0.113

1.930±0.111

Normal control+glucose 30C

9

4.807±0.118*

1.995±0.115*

1 mmol/L arsenite

9

0.834±0.111*

0.579±0.115*

1 mmol/L arsenite+placebo 30C

9

0.834±0.115

0.575±0.113

1 mmol/L arsenite+glucose 30C

9

1.202±0.115△

0.779±0.112△

2 mmol/L arsenite

9

0.819±0.115*

0.559±0.113*

2 mmol/L arsenite+placebo 30C

9

0.817±0.118

0.584±0.119

2 mmol/L arsenite+glucose 30C

9

1.776±0.115▲

0.834±0.111▲

*P<0.05, vs normal control; P<0.05, vs placebo-treated positive control (1 mmol/L arsenite); P<0.05, vs placebo-treated positive control (2 mmol/L arsenite). ATP: adenosine triphosphate; SEM: standard error of mean.


     Addition of glucose 30C to 1 mmol/L and 2 mmol/L sodium arsenite-treated cells showed a significant increase in ATP concentration both at 45 min (P<0.05) and 90 min (P<0.05), respectively, as compared to only 1 mmol/L and 2 mmol/L sodium arsenite treatments. Addition of glucose 30C to the normal medium also produced an increase in ATP concentration as compared to that of the control set both at 45 min (0.057 μmol/L per cell) and 90 min (0.065 μmol/L per cell) intervals. Addition of the placebo did not make any significant difference in ATP concentration either at 45 min or 90 min intervals. The overall concentration of ATP was found to be reduced at 90 min as compared to 45 min indicating that the ATP was degraded or utilized by the cell itself.
2.5  Assay of membrane potential of E. coli cells by spectroflurimetric study  The membrane potential in E. coli significantly decreased both at 45 min (P<0.05) and 90 min (P<0.05) after addition of 1 mmol/L and 2 mmol/L sodium arsenite (Table 6).

Table 6  Results of cell membrane potential

(Mean±SEM, mV)

Group

n

Membrane potential

45 min

90 min

Normal control

9

68.80±2.00

94.10±2.65

Normal control+glucose 30C

9

54.50±1.45*

88.70±2.40*

1 mmol/L arsenite

9

33.50±1.25*

65.80±1.55*

1 mmol/L arsenite+placebo 30C

9

31.90±1.50

63.70±1.80

1 mmol/L arsenite+glucose 30C

9

15.80±1.60

48.80±1.69

2 mmol/L arsenite

9

30.20±1.50*

62.70±1.90*

2 mmol/L arsenite+placebo 30C

9

28.70±1.95

61.10±2.00

2 mmol/L arsenite+glucose 30C

9

10.30±1.60

44.70±1.60

*P<0.05, vs normal control; P<0.05, vs placebo-treated positive control (1 mmol/L arsenite); P<0.05, vs placebo-treated positive control (2 mmol/L arsenite). SEM: standard error of mean.


     Addition of glucose 30C to 1 mmol/L and 2 mmol/L sodium arsenite-treated cells showed a significant decrease in their membrane potential after 45 min (P<0.05) and 90 min (P<0.05) respectively as compared to only 1 mmol/L and 2 mmol/L sodium arsenite treatments. Addition of glucose 30C in normal medium also produced a decrease in membrane potential as compared to that of the control set both at 45 min (14.3 mV) and 90 min (5.4 mV) intervals. Placebo did not make any significant difference in membrane potential, measured in E. coli either at 45 min or at 90 min. Decreasing of membrane potential increased the amount of glucose uptake, that is, less membrane potential of cells indicated more glucose uptake.
2.6  Assay of membrane potential of E. coli cells by flow-cytometry study  When the flow-cytometry study was performed separately on the stained (with the fluorescence dye 3,3′-diphenylthiocarbocyanine iodide) and unstained E. coli cells, maximum number of unstained cells were found to be located at the lower left region (Figure 2A), while the stained cells were maximally populated at the lower right region (Figure 2B). On the other hand, after treatment of the stained cells with 1 mmol/L and 2 mmol/L sodium arsenite, the location of the fluorescence was shifted towards the left (Figures 2C and 2D); this implied considerable release of fluorophores from the cells, which again signified the lowering of the membrane potential of the arsenite-treated cells. Again some intense fluorescence shifting towards the left side was observed when glucose 30C was added along with 1 mmol/L and 2 mmol/L sodium arsenite (Figures 2G and 2H).

 

Figure 2  Analysis of membrane potential by flow-cytometry

Cell membrane potential was measured by a flow-cytometer after two different doses of sodium arsenite insult. A: Normal control cells; B: Glucose 30C-treated control cells; C: 1 mmol/L arsenite-treated cells; D: 2 mmol/L arsenite-treated cells; E: 1 mmol/L arsenite and placebo-treated cells; F: 2 mmol/L arsenite and placebo-treated cells; G: 1 mmol/L arsenite and glucose 30C-treated cells; H: 2 mmol/L arsenite and glucose 30C-treated cells.

 

Figure 3  Gene expression analysis by reverse transcriptase-polymerase chain reaction

Arbitrary band intensities of ptsG (glucose permease gene) were analysed against the house keeping gene (G-3-PDH) under different conditions. (a) and (d) represent the expression of house keeping gene after 1 mmol/L and 2 mmol/L of sodium arsenite addition, respectively; (b) Expression of ptsG at 45 min after the addition of 1 mmol/L arsenite; (c) Expression of ptsG at 90 min after the addition of 1 mmol/L arsenite; (e) Expression of ptsG at 45 min after the addition of 2 mmol/L arsenite; (f) Expression of ptsG at 90 min after the addition of 2 mmol/L arsenite. The components of different lanes are: Ln1: Normal control cells; Ln2: Sodium arsenite-treated cells; Ln3: Sodium arsenite plus placebo-treated cells; Ln4: Sodium arsenite plus glucose 30C-treated cells; Ln5: Normal control plus glucose 30C-treated cells.


2.7  Gene expression analysis by reverse transcriptase-PCR method  The expression levels of glucose permease (GeneBank accession No. ECK1087) and house-keeping gene (G-3-PDH, GeneBank accession No. U82259) of E. coli cells in different control and treatment groups are summarized in Figure 3 and data are summarized in Table 7.

 

Table 7  Arbitrary band intensity of ptsG gene measured by RT-PCR method

(Mean±SEM)

Group

n

Band intensity

45 min

90 min

Normal control

9

1.00±0.10

1.00±0.09

Normal control+glucose 30C

9

1.19±0.06*

1.31±0.09*

1 mmol/L arsenite

9

1.14±0.04*

1.16±0.07*

1 mmol/L arsenite+placebo 30C

9

1.04±0.08

1.03±0.06

1 mmol/L arsenite+glucose 30C

9

1.22±0.05

1.28±0.09

2 mmol/L arsenite

9

1.12±0.10*

1.27±0.12*

2 mmol/L arsenite+placebo 30C

9

1.09±0.20

1.07±0.12

2 mmol/L arsenite+glucose 30C

9

1.41±0.12

1.42±0.15

*P<0.05, vs normal control; P<0.05, vs placebo-treated positive control (1 mmol/L arsenite); P<0.05, vs placebo-treated positive control (2 mmol/L arsenite). RT-PCR: reverse transcription-polymerase chain reaction; SEM: standard error of mean.


     The arbitrary band intensity level significantly increased both at 45 min (P<0.05) and 90 min (P<0.05) intervals after the addition of 1 mmol/L and 2 mmol/L sodium arsenite. The arbitary band intensity level increased about 0.11 fold in 2 mmol/L arsenite insult than that of 1 mmol/L arsenite. Again the intensity of the band was known to be expression-dependent, that is, more intense band indicates more genetic level expression.
     Addition of glucose 30C to 1 mmol/L and 2 mmol/L sodium arsenite-treated cells showed a significant increase in their band intensity after 45 min (P<0.05) and 90 min (P<0.05) respectively as compared to only 1 mmol/L and 2 mmol/L sodium arsenite treatments. Addition of glucose 30C in normal medium also produced little increase in band intensity as compared to that of control set both at 45 min (0.53 fold) and 90 min (0.8 fold) intervals. Addition of the placebo did not produce any significant difference in band intensity in E. coli either at 45 min or 90 min.
2.8  Gene expression analysis by quantitative real-time reverse transcription-PCR  The relative gene expressions of ptsG (normalized by house-keeping gene G-3-PDH) of E. coli cells in different control and treatment groups are summarized in Table 8.

 

Table 8  Gene expression of ptsG measured by real-time PCR method

(Mean±SEM)

Group

n

Gene expression

45 min

90 min

Normal control

9

1.00±0.15

1.00±0.18

Normal control+glucose 30C

9

1.15±0.25*

1.56±0.88*

1 mmol/L arsenite

9

1.67±0.49*

4.11±0.89*

1 mmol/L arsenite+placebo 30C

9

1.50±0.49

3.18±1.25

1 mmol/L arsenite+glucose 30C

9

2.53±0.50

5.02±0.65

2 mmol/L arsenite

9

3.83±0.20*

6.72±0.45*

2 mmol/L arsenite+placebo 30C

9

2.28±0.19

6.20±0.44

2 mmol/L arsenite+glucose 30C

9

4.75±0.50

7.84±0.68

*P<0.05, vs normal control; P<0.05, vs placebo-treated positive control (1 mmol/L arsenite); P<0.05, vs placebo-treated positive control (2 mmol/L arsenite). PCR: polymerase chain reaction; SEM: standard error of mean.


     The relative gene expression level significantly increased both at 45 min (P<0.05) and 90 min (P<0.05) intervals after the addition of 1 mmol/L and 2 mmol/L sodium arsenite. The expression level increased to approximately 2.16 fold in 2 mmmol/L arseite-treated cells than that of 1 mmol/L arsenite-treated ones. Addition of glucose 30C to 1 mmol/L and 2 mmol/L sodium arsenite-treated cells showed a significant increase in their relative genetic expression after 45 min (P<0.05) and 90 min (P<0.05), respectively, as compared to only 1 mmmol/L and 2 mmol/L sodium arsenite treatments. Addition of glucose 30C in normal medium also increased glucose permease gene expression (by 0.22 fold and 0.56 fold at 45 min and 90 min, respectively). All expressions were measured against control cells (taking the expression of control cells as unity). Addition of the placebo did not make any significant difference in gene expression in E. coli either at 45 min or 90 min.
2.9  Arsenic measurement in spent medium (extracellular)  The arsenic concentration in spent medium significantly increased both at 45 min (P<0.05) and 90 min (P<0.05) after the addition of 1 mmol/L and 2 mmol/L sodium arsenite, respectively, compared to that of the control set (Table 9). Arsenic concentration in the spent media of 2 mmol/L arsenite insult was higher than that of 1 mmol/L arsenite treatment. Addition of glucose 30C to 1 mmol/L and 2 mmol/L sodium arsenite-treated cells showed a significantly increased concentration of arsenic in spent medium both at 45 min (P<0.05) and 90 min (P<0.05), respectively, as compared to that of only 1 mmol/L and 2 mmol/L sodium arsenite treatments. Addition of glucose 30C in normal medium also produced an increase in arsenic concentration in spent medium as compared to that of the control set both at 45 min (22.23 μg/L) and 90 min (25.68 μg/L) intervals, where the placebo did not.

 

Table 9  Results of extracellular arsenic measurement

(Mean±SEM, μg/L)

Group

n

Arsenic measurement

45 min

90 min

Normal control

9

196.67±17.0

227.32±20.0

Normal control+
glucose 30C

9

218.90±21.0*

253.00±25.0*

1 mmol/L arsenite

9

295.79±23.0*

321.24±26.0*

1 mmol/L arsenite+
placebo 30C

9

289.93±22.0

314.71±28.0

1 mmol/L arsenite+
glucose 30C

9

337.50±22.0△

356.80±27.5△

2 mmol/L arsenite

9

368.18±26.0*

419.05±32.0*

2 mmol/L arsenite+
placebo 30C

9

364.92±25.0

413.83±30.5

2 mmol/L arsenite+
glucose 30C

9

398.00±24.6▲

445.80±31.8▲

*P<0.05, vs normal control; P<0.05, vs placebo-treated positive control (1 mmol/L arsenite); P<0.05, vs placebo-treated positive control (2 mmol/L arsenite). SEM: standard error of mean.

2.10  Arsenic measurement in E. coli cells (intracellular)  The arsenic concentration in E. coli cells significantly increased both at 45 min (P<0.05) and 90 min (P<0.05) after the addition of 1 mmol/L and 2 mmol/L sodium arsenite, respectively, compared to that of the control set (Table 10).
 

Table 10  Results of intracellular arsenic measurement

(Mean±SEM, μg/L per cell)

Group

n

Arsenic measurement

45 min

90 min

Normal control

9

1.54±0.12

0.35±0.02

Normal control+
glucose 30C

9

1.32±0.15*

0.22±0.05*

1 mmol/L arsenite

9

19.24±1.50*

2.79±0.80*

1 mmol/L arsenite+
placebo 30C

9

19.62±1.80

2.81±0.70

1 mmol/L arsenite+
glucose 30C

9

16.90±1.80△

2.54±0.90△

2 mmol/L arsenite

9

22.04±2.34*

3.44±1.10*

2 mmol/L arsenite+
placebo 30C

9

21.82±2.00

3.50±0.85

2 mmol/L arsenite+
glucose 30C

9

20.40±2.12▲

2.80±1.20▲

*P<0.05, vs normal control; P<0.05, vs placebo-treated positive control (1 mmol/L arsenite); P<0.05, vs placebo-treated positive control (2 mmol/L arsenite). SEM: standard error of mean.


     The intracellular arsenic concentration decreased significantly after the addition of glucose 30C to 1 mmol/L and 2 mmol/L sodium arsenite-treated cells both at 45 min (P<0.05) and 90 min (P<0.05), respectively, compared to only arsenic-treated cells. Addition of glucose 30C in normal medium also produced a little decrease in intracellular arsenic concentration as compared to that of the control set both at 45 min (0.22 μg/L per cell) and 90 min (0.13 μg/L per cell) intervals. The addition of the placebo did not produce any significant difference in intracellular arsenic concentration either at 45 min or 90 min. However, the intracellular arsenic concentration of 2 mmol/L arsenite-intoxicated cells was 2 fold higher than that of 1 mmol/L arsenite-treated cells.

Jump to Section
-  Top
-  Article & Author Info
-  Introduction
-  Materials and methods
-  Results
-  Discussion
-  Acknowledgements
-  Competing interests
-  References
  

3  Discussion
     When E. coli was exposed to a low dose of sodium arsenite (AsNaO2), glucose uptake increased. This is due to the activation of the ars operon to expel arsenic from the cell. There are two types of arsenic resistant membrane proteins (ArsA and ArsB) which are located in the ars operon system18, 31. When ArsA is co-expressed with ArsB, an ArsAB complex is formed which is obligatorily coupled to ATP32. In E. coli, arsenite is extruded from the cells by the ArsAB ATPase pump. Initially ATP is bound to ArsA/ArsB protein which is converted to ADP after extruding arsenite from the bacteria. Hence ATP is continuously needed to extrude arsenite, for which more glucose uptake becomes necessary for replenishing ATP. Again, the production of ATP becomes half (4 mol of ATP was produced instead of 8 mol from 1 mol of glucose breakdown through glycolysis pathway) in the presence of arsenite. So, glucose uptake increases significantly to compensate the impaired production of ATP from glycolytic pathway and to increase the rate of ATP production, which is required for the extrusion of arsenic via energy-dependent functioning of ars operon.
     In the present study, therefore, the increased uptake of glucose by E. coli in arsenite-supplemented medium was in conformity with the need of the organism, and it was quite expected that addition of 1% or 3% glucose in the medium would promote further glucose uptake. This increment in the glucose uptake rate was further supported by the data of specific activity of hexokinase and glucokinase, study of expression level of glucose carrier protein, glucose permease, and the study of membrane potential of E. coli cells under different conditions and the measurement of total ATP concentration. The specific activities of hexokinase and glucokinase were observed to decrease due to an increase in the glucose uptake rate, this is because the activity of an enzyme is always constant and if substrate concentration (glucose in this study) increases then the amount of enzyme (required to metabolize substrate) also increases and thus specific activity decreases. That is why specific activity of hexokinase and glucokinase was found to be decreased in arsenite-intoxicated cells, as compared to the control cells (because arsenic-treated cells showed higher uptake rate than the control cells). A decrease in the specific activity of hexokinase and glucokinase would depict that these enzymes were actively involved in the breakdown of glucose in the glycolytic pathway, signifying further that the enhanced glucose intake was partly utilized to gear up ATP production. This also compensated to some extent the loss caused due to the impaired activity of the phosphoglyceral kinase19. However, the overall extent of glucose uptake was found to be reduced at 90 min indicating that the requirement for glucose uptake was reduced after a certain period of time and there could be a threshold level or a saturation point after which glucose uptake would decline.
     The concentration of ATP in the arsenite-treated cells was found to be decreased against the controlled cells. One explanation for this could be that the constant utilization of ATP by arsenite-treated cells for the extrusion of arsenic from the cells requires expenditure of energy for their survival. This statement would find support from the fact that the amount of arsenic present in the additional glucose 30C-treated spent medium (extracellular arsenic concentration) increased but the arsenic concentration within the cells decreased with the lapse of time.
     Thus, the results would confirm that the arsenic extrusion mechanism in E. coli is primarily energy-dependent and the greater uptake of glucose was the primary step to ensure rapid utilization of ATP at the expense of which arsenic was being extruded from the cell. Gradual depletion of intra-cellular arsenic in the cell and its release into the medium with the lapse of time would explain the observed result showing an increase in extra-cellular arsenic concentrations as compared to the placebo control.
     However, why the addition of glucose 30C that did not contain any original molecule of glucose not only increased glucose uptake by E. coli, but also showed an apparent increase in ATP concentration, was more challenging to explain with our current understanding. However, one hypothesis to explain this could be that the ultra-highly diluted glucose 30C had something in it (“molecular imprints” of glucose?), which resembled the original molecule of glucose. For this, they could mimic the role played by the original glucose molecules in increasing glucose uptake by gene induction and thereby increasing ATP production. To verify this contention, the data on the membrane potential of the arsenite, arsenite plus glucose 30C and only glucose 30C treated cells were analyzed. The addition of glucose 30C to 1 mmol/L and 2 mmol/L sodium arsenite-treated cells showed a significant decrease in their membrane potential as compared to only 1 mmol/L and 2 mmol/L sodium arsenite treatments. The data revealed that the membrane potentials decreased significantly in all the cases, implicating thereby the uptake of an external substance (glucose in this study) into the cell system33. Therefore, the results of the flow-cytometry study were in strong conformity with those of the spectrofluorimetric study.
     The increased expression level of glucose permease tested by RT-PCR and quantitative real-time PCR in arsenite-treated cells, arsenite plus glucose 30C-treated cells and only glucose 30C-treated cells would also provide additional support to this contention and that the glucose carrier protein also had a significant role in glucose insertion into the cells. However, in the absence of any physical presence of glucose molecule in glucose 30C, how exactly the modulations observed could be possible while the placebo 30C, which did not contain any initial glucose molecule (contained only 70% succussed ethanol) could not evoke any such responses, is a matter that needs further scientific scrutiny. Incidentally, in ultra-high dilutions of homeopathic drugs, some distinctive physico-chemical features have already been reported by some other studies34-40. The leading current proposal for the mode of action of such “ultra-molecular dilutions” is that water (or aquatic ethanol) is capable of storing information relating to substances with which it has been in contact and subsequently can transmit this information to a pre-sensitized biological system. The process is believed to be mediated by structural modification of water (or aquatic ethanol), analogous to storage of information by magnetic media41. Such information is retained in physical, rather than chemical form. Thus the molecular architechture of water (or aquatic ethanol) has a key role to play in understanding homeopathic mechanisms of action42, 43. Therefore, further studies on their physico-chemical properties that make glucose 30C so different in action in regard to glucose uptake in E. coli, are warranted for understanding the mechanistic principle more precisely, which may reveal a gene regulatory role of ultra-highly diluted agitated solutions (Tables 7 and 8) or understanding the ultimate molecular mechanism of biological action, as proposed earlier by Khuda-Bukhsh6-9. Finally, it seems that the “memory of water” hypothesis proposed originally by Davenas et al44 should again be put to more elaborate scientific explorations, preferably by well-designed multi-center studies.

Jump to Section
-  Top
-  Article & Author Info
-  Introduction
-  Materials and methods
-  Results
-  Discussion
-  Acknowledgements
-  Competing interests
-  References
  

4  Acknowledgements
     This work was financially supported by a grant sanctioned to Prof. A.R. Khuda-Bukhsh, Department of Zoology, University of Kalyani, India by Boiron Laboratory, Lyon, France. The authors extend their sincere thanks to Dr. P. Belon, Ex-Director, Boiron Laboratory, for providing us the homeopathic glucose 30C and the placebo. They are also thankful to Dr. Mamata Chawla Sarkar and Mr. Parikshit Bagchi, Department of Virology, NICED, India and Dr. Samir Kumar Mukherjee and Mr. Arghya Bandyopadhyay, Department of Microbiolology, University of Kalyani, India for permitting the authors to use their laboratory for conducting a part of the work.

Jump to Section
-  Top
-  Article & Author Info
-  Introduction
-  Materials and methods
-  Results
-  Discussion
-  Acknowledgements
-  Competing interests
-  References
  

5  Competing interests
     The authors declare that they have no competing interests.

Jump to Section
-  Top
-  Article & Author Info
-  Introduction
-  Materials and methods
-  Results
-  Discussion
-  Acknowledgements
-  Competing interests
-  References
  
References
1. Vickers AJ, Fisher P, Smith C, Wyllie SE, Rees R. Homeopathic Arnica 30× is ineffective for muscle soreness after long-distance running: a randomized, double-blind, placebo-controlled trial[J]. Clin J Pain, 1998, 14(3) : 227-231.
    
2. Lewith GT, Watkins AD, Hyland ME, Shaw S, Broomfield JA, Dolan G, Holgate ST. Use of ultramolecular potencies of allergen to treat asthmatic people allergic to house dust mite: double blind randomised controlled clinical trial[J]. BMJ, 2002, 324(7336) : 520.
    
3. Ernst E. A systematic review of systematic reviews of homeopathy[J]. Br J Clin Pharmacol, 2002, 54(6) : 577-582.
    
4. Shang A, Huwiler-Müntener K, Nartey L, Jüni P, Drig S, Sterne JA, Pewsner D, Egger M. Are the clinical effects of homoeopathy placebo effects? Comparative study of placebo-controlled trials of homoeopathy and allopathy[J]. Lancet, 2005, 366(9487) : 726-732.
    
5. House of Commons Science and Technology Committee. Evidence check 2: homeopathy. Fourth report of session 2009-10: Report, together with formal minutes, oral and written evidence. London: The Stationery Office Limited. 2010
6. Khuda-Bukhsh AR. Potentized homoeopathic drugs act through regulation of gene-expression: a hypothesis to explain their mechanism and pathways of action in vitro[J]. Complement Ther Med, 1997, 59(1) : 43-46.
[Elsevier]    
7. Khuda-Bukhsh AR. Towards understanding molecular mechanisms of action of homeopathic drugs: an overview[J]. Mol Cell Biochem, 2003, 253(1-2) : 339-345.
    
8. Khuda-Bukhsh AR. Laboratory research in homeopathy: pro[J]. Integr Cancer Ther, 2006, 5(4) : 320-332.
    
9. Khuda-Bukhsh AR. Mice as a model for homeopathy research[J]. Homeopathy, 2009, 98(4) : 267-279.
    
10. Le Gall T, Clermont O, Gouriou S, Picard B, Nassif X, Denamur E, Tenaillon O. Extraintestinal virulence is a coincidental by-product of commensalism in B2 phylogenetic group Escherichia coli strains[J]. Mol Biol Evol, 2007, 24(11) : 2373-2384.
    
11. Bhattacharjee H, Rosen BP. Arsenic metabolism in prokaryotic and eukaryotic microbes. In: Nies DH, Simon S. Molecular microbiology of heavy metals[M]. Berlin: Springer, 2007. 371.
  
12. Lin YF, Yang J, Rosen BP. ArsD residues Cys12, Cys13, and Cys18 form an As(Ⅲ)-binding site required for arsenic metallochaperone activity[J]. J Biol Chem, 2007, 282(23) : 16783-16791.
    
13. Lin YF, Yang J, Rosen BP. ArsD: an As(Ⅲ) metallochaperone for the ArsAB As(Ⅲ)-translocating ATPase[J]. J Bioenerg Biomembr, 2007, 39(5-6) : 453-458.
    
14. Xu C, Rosen BP. Metalloregulation of soft metal resistance pumps. In: Sarkar B. Metals and genetics[M]. New York: Plenum Press, 1999. 5-19.
15. San Francisco MJ, Tisa LS, Rosen BP. Identification of the membrane component of the anion pump encoded by the arsenical resistance operon of R-factor R773[J]. Mol Microbiol, 1989, 3(1) : 15-21.
    
16. Tisa LS, Rosen BP. Molecular characterization of an anion pump. The ArsB protein is the membrane anchor for the ArsA protein[J]. J Biol Chem, 1990, 265(1) : 190-194.
  
17. Rosen BP, Weigel U, Karkaria C, Gangola P. Molecular characterization of an anion pump. The arsA gene product is an arsenate (antimonate)-stimulated ATPase[J]. J Biol Chem, 1988, 263(7) : 3067-3070.
  
18. Dey S, Dou D, Rosen BP. ATP-dependent arsenite transport in everted membrane vesicles of Escherichia coli[J]. J Biol Chem, 1994, 269(4) : 25442-25446.
  
19. Yu MH. Environmental toxicology: biological and health effects of pollutants[M]. 2nd ed. Boca Raton: CRC Press, 2005.
20. Mokrasch LC. Analysis of hexose phosphates and sugar mixtures with the anthrone reagent[J]. J Biol Chem, 1954, 208(1) : 55-59.
  
21. Racker E. Spectrophotometric measurement of hexokinase and phosphohexokinase activity[J]. J Biol Chem, 1947, 167(3) : 843-854.
  
22. Storer AC, Cornish-Bowden A. The kinetics of coupled enzyme reactions. Applications to the assay of glucokinase, with glucose 6-phosphate dehydrogenase as coupling enzyme[J]. Biochem J, 1974, 141(1) : 205-209.
  
23. Kangas L, Grnroos M, Nieminen AL. Bioluminescence of cellular ATP: a new method for evaluating cytotoxic agents in vitro[J]. Med Biol, 1984, 62(6) : 338-343.
  
24. Ingram PR, Pitt AR, Wilson CG, Olejnik O, Spickett CM. A comparison of the effects of ocular preservatives on mammalian and microbial ATP and glutathione levels[J]. Free Radic Res, 2004, 38(7) : 739-750.
    
25. O’Keefe D, Collier RJ. Cloned diphtheria toxin within the periplasm of Escherichia coli causes lethal membrane damage at low pH[J]. Proc Natl Acad Sci U S A, 1989, 86(1) : 343-346.
    
26. Amor KB, Breeuwer P, Verbaarschot P, Rombouts FM, Akkermans AD, De Vos WM, Abee T. Multiparametric flow cytometry and cell sorting for the assessment of viable, injured, and dead bifidobacterium cells during bile salt stress[J]. Appl Environ Microbiol, 2002, 68(11) : 5209-5216.
    
27. Sims PJ, Waggoner AS, Wang CH, Hoffman JF. Studies on the mechanism by which cyanine dyes measure membrane potential in red blood cells and phosphatidylcholine vesicles[J]. Biochemistry, 1974, 13(16) : 3315-3330.
    
28. Chowdhury R, Dutta A, Chaudhuri SR, Sharma N, Giri AK, Chaudhuri K. In vitro and in vivo reduction of sodium arsenite induced toxicity by aqueous garlic extract[J]. Food Chem Toxicol, 2008, 46(2) : 740-751.
    
29. Bagchi P, Dutta D, Chattopadhyay S, Mukherjee A, Halder UC, Sarkar S, Kobayashi N, Komoto S, Taniguchi K, Chawla-Sarkar M. Rotavirus nonstructural protein 1 suppresses virus-induced cellular apoptosis to facilitate viral growth by activating the cell survival pathways during early stages of infection[J]. J Virol, 2010, 84(13) : 6834-6845.
    
30. Behari JR, Prakash R. Determination of total arsenic content in water by atomic absorption spectroscopy (AAS) using vapour generation assembly (VGA)[J]. Chemosphere, 2006, 63(1) : 17-21.
    
31. Sato T, Kobayashi Y. The ars operon in the skin element of Bacillus subtilis confers resistance to arsenate and arsenite[J]. J Bacteriol, 1998, 180(7) : 1655-1661.
  
32. Rosen BP. Biochemistry of arsenic detoxification[J]. FEBS Lett, 2002, 529(1) : 86-92.
    
33. Panja S, Saha S, Jana B, Basu T. Role of membrane potential on artificial transformation of E. coli with plasmid DNA[J]. J Biotechnol, 2006, 127(1) : 14-20.
    
34. Elia V, Napoli E, Germano R. The ‘Memory of Water’: an almost deciphered enigma. Dissipative structures in extremely dilute aqueous solutions[J]. Homeopathy, 2007, 96(3) : 163-169.
    
35. Rey L. Thermoluminescence of ultra-high dilutions of lithium chloride and sodium chloride[J]. Physica A, 2003, 323: 67-74.
    
36. Lo SY, Bonavida B. A book containing a dozen experiments using IE crystals. In: Lo SY, Bonavida B. Proceeding of the first international symposium on physical, chemical and biological properties of stable water (IE) clusters. Singapore City: World Scientific. 1998: 81-90
37. Anagnostatos GS, Pissis P, Viras K, Soutzidou M. Theory and experiments on high dilutions. In: Ernst E, Hahn EG. Homeopathy: a critical appraisal. Oxford: Butterworth-Heinemann. 1998: 153-166
38. Rao ML, Roy R, Bell IR, Hoover R. The defining role of structure (including epitaxy) in the plausibility of homeopathy[J]. Homeopathy, 2007, 96(3) : 175-182.
    
39. Weingrtner O. The nature of the active ingredient in ultramolecular dilutions[J]. Homeopathy, 2007, 96(3) : 220-226.
    
40. Milgrom LR. Conspicuous by its absence: the memory of water, macro-entanglement, and the possibility of homeopathy[J]. Homeopathy, 2007, 96(3) : 209-219.
    
41. Bellavite P, Signorini A. The emerging science of homeopathy: complexity, biodynamics, and nanopharmacology[M]. 2nd ed. Berkeley: North Atlantic Books, 2002. 408.
42. Anick DJ, Ives JA. The silica hypothesis for homeopathy: physical chemistry[J]. Homeopathy, 2007, 96(3) : 189-195.
    
43. Center of Conciousness Studies, The University of Arizona. Proceedings of the eighteenth annual international, interdisciplinary conference on the fundamental question of how the brain produces conscious experience. Stockholm, Sweden, May 3-7, 2011
44. Davenas E, Beauvais F, Amara J, Oberbaum M, Robinzon B, Miadonna A, Tedeschi A, Pomeranz B, Fortner P, Belon P. Human basophil degranulation triggered by very dilute antiserum against IgE[J]. Nature, 1988, 333(6176) : 816-818.
    
Jump to Section
-  Top
-  Article & Author Info
-  Introduction
-  Materials and methods
-  Results
-  Discussion
-  Acknowledgements
-  Competing interests
-  References
  
This article has been cited by other articles ( Within JCIM )
1. Potentized homeopathic drug Arsenicum Album 30C inhibits intracellular reactive oxygen species generation and up-regulates expression of arsenic resistance gene in arsenite-exposed bacteria Escherichia coli. 2012, 10(2)
2. Phenotypic evidence of ultra-highly diluted homeopathic remedies acting at gene expression level: a novel probe on experimental phage infectivity in bacteria. 2012, 10(4)

JCIM
Open Access
THIS ARTICLE
-  Abstract
-  Full text
-  Download PDF file
-  Send to a friend
-  Related articles in JCIM
-  Cited in JCIM
-  Reader's comments
-  Send a comment
    
Reader's comments
1. ky2apG http://www.FyLitCl7Pf7kjQdDUOLQOuaxTXbj5iNG.com (2016-10-15 0:00:00)
2. ky2apG http://www.FyLitCl7Pf7kjQdDUOLQOuaxTXbj5iNG.com (2016-10-15 0:00:00)

Send a comment

 Home | Current Issue | Past Issues | Search | CollectionsRSS | PDA Services | FAQ | SHCIM Online | Chinese
Copyright © 2003-2012 by JCIM Press. All rights reserved. ISSN 1672-1977