Updated Tuesday, September 26, 2017
JCIM & JIM
Open Access
THIS ARTICLE
-  Abstract
-  Full text
-  Download PDF file
-  Send to a friend
-  Related articles in JCIM & JIM
-  Cited in JCIM & JIM
-  Reader's comments
-  Send a comment
 Language Polishing
Original Experimental Research
Journal of Chinese Integrative Medicine: Volume 10, 2012   Issue 2
Potentized homeopathic drug Arsenicum Album 30C inhibits intracellular reactive oxygen species generation and up-regulates expression of arsenic resistance gene in arsenite-exposed bacteria Escherichia coli
1. Arnab De (Cytogenetics and Molecular Biology Laboratory, Department of Zoology, University of Kalyani, Kalyani 741235, India )
2. Durba Das (Cytogenetics and Molecular Biology Laboratory, Department of Zoology, University of Kalyani, Kalyani 741235, India )
3. Suman Dutta (Cytogenetics and Molecular Biology Laboratory, Department of Zoology, University of Kalyani, Kalyani 741235, India )
4. Debrup Chakraborty (Cytogenetics and Molecular Biology Laboratory, Department of Zoology, University of Kalyani, Kalyani 741235, India )
5. Naoual Boujedaini (Boiron Laboratory, Lyon, France )
6. Anisur Rahman Khuda-Bukhsh (Cytogenetics and Molecular Biology Laboratory, Department of Zoology, University of Kalyani, Kalyani 741235, India E-mail: khudabukhsh_48@rediffmail.com)
OBJECTIVE: To examine if potentized homeopathic drug Arsenicum Album 30C (Ars Alb 30C) can reduce sodium arsenite-induced toxicity in Escherichia coli.
METHODS: E. coli were exposed to low arsenite insult after they grew up to log phase in standard Luria-Bertani medium. E. coli were treated with 1 or 2 mmol/L sodium arsenite alone (control), or Ars Alb 30C was added to the medium of a subset of sodium arsenite-treated bacteria (drug-treated), or homeopathically agitated alcohol was added to the medium containing a subset of sodium arsenite-treated bacteria (placebo-treated). A sub-set of untreated E. coli served as the negative control. Glucose uptake, specific activities of hexokinase, lipid peroxidase (LPO), superoxide dismutase (SOD) and catalase, intra- and extra-cellular sodium arsenite content, cell growth, cell membrane potential, DNA damage, intracellular reactive oxygen species (ROS), adenosine triphosphate (ATP) and free glutathione content and expressions of arsB and ptsG gene in normal control, sodium arsenite-treated, drug-treated and placebo-treated E. coli were analyzed. Treatments were blinded and randomized.
RESULTS: In sodium arsenite-treated E. coli, glucose uptake, intracellular ROS, LPO and DNA damage increased along with decrease in the specific activities of hexokinase, SOD and catalase, intracellular ATP and free glutathione contents and cell membrane potential and growth, and there were increases in expression levels of arsB gene and ptsG gene. Ars Alb 30C administration reduced arsenic toxicity in E. coli by inhibiting generation of ROS and increasing tolerance to arsenite toxicity and cell growth.
CONCLUSION: Ars Alb 30C ameliorated arsenic toxicity and DNA damage, validating efficacy of ultra-highly diluted remedies used in homeopathy.

Received August 8, 2011; accepted November 14, 2011; published online February 15, 2012.
Full-text LinkOut at PubMed. Journal title in PubMed: Zhong Xi Yi Jie He Xue Bao.

基金项目:This work was supported by a research grant from Boiron Laboratories, Lyon, France
Correspondence: Anisur Rahman Khuda-Bukhsh, PhD, Professor; Tel: +91-33-25828750-315; E-mail: prof_arkb@yahoo.co.in, khudabukhsh_48@rediffmail.com

  

     Homeopathy is a holistic method of treatment that uses microdoses of very high dilutions of natural substances originating from plants, minerals or animal parts. This novel mode of treatment was first introduced and practiced by a German physician named Samuel Hahnemann (1755—1843). Homeopathy became a treatment based on the basic tenet, that is, “like cures like”, or more precisely “similia similibus curentur”. In other words, this means that symptoms that are produced by chronic feeding of drug to a normal healthy person can be successfully removed by the application of the same drug at highly diluted micro-doses. The initial drug substance is generally dissolved in aquatic ethanol (mostly 70%), known as the “mother tincture”. When 1 mL of the mother tincture is diluted with 99 mL of aquatic ethanol (solvent vehicle of the drug) and given 10 jerks or succussions the potency 1C is produced. When 1 mL of the potency 1C is again diluted with 99 mL of aquatic ethanol and given 10 jerks, the potency 2C is produced, and so on. Therefore, when the drug attains potency 12C and above, it becomes diluted to 10-24 (beyond Avogadro’s limit) and more and the existence of even a single molecule of the original drug substance in such high potencies becomes highly improbable (theoretically), but some researchers demonstrated the existence of nanoparticles of the original drug substances in such ultra-highly diluted homeopathic drugs[1]. Herein lays the controversy as to whether dilutions beyond Avogadro’s limit can have any effects on living systems. Although homeopathic clinicians and practitioners strongly believe that these diluted drugs can act to remove disease symptoms and cure patients[2,3], others do not accept that any ultra-highly diluted drugs can have demonstrable effects on any living system and the ability of such highly diluted drugs in ameliorating or curing any disease becomes questionable for methodological shortcomings, or for some other flaws in the reports[4-6].
     In our earlier experiment[7], we could mainly demonstrate that homeopathically ultra-highly diluted glucose 30C could enhance glucose uptake in arsenite-treated E. coli to augment adenosine triphosphate (ATP) synthesis required for arsenic expulsion by the arsenic pump. In continuation of that study, we conducted the present experiment to test the hypothesis if a homeopathically potentized drug, Arsenicum Album 30C (Ars Alb 30C) (derived from arsenic trioxide by diluting the original mother tincture 10-60 times with serial dilutions and agitations) could directly combat arsenic toxicity and reduce generation of intracellular reactive oxygen species (ROS) in E. coli subjected to toxic stress of sodium arsenite and whether it has any effect on any relevant gene regulatory system. We used E. coli as a model organism because it represents a unicellular system, easy to culture and it is accepted worldwide as a prokaryotic model for conducting critical experiments as it possesses a simple genetic organization. Additionally, much of its genetic regulatory system had already been known[8,9]. In our earlier study[7], while our focus was mainly centered on the glucose uptake level and associated biochemical or gene-regulatory changes altered by a homeopathically diluted glucose 30C in sodium arsenite-intoxicated E. coli, in this study we made an attempt to study certain stress-related biochemical and molecular changes in sodium arsenite-intoxicated E. coli and their possible modulations by an ultra-highly diluted arsenic trioxide (Ars Alb 30C), to compare the effects of these two ultra-highly diluted homeopathic preparations. Another goal of this study was to test the hypothesis if E. coli showed differential molecular and biochemical responses as a result of either of these two homeopathically ultra-highly diluted remedies, which might throw additional insight into the gene regulatory molecular mechanisms of action of the potentized homeopathic remedies.

 
  


1  Materials and methods
1.1  Culture and treatment groups of
E. coli  E. coli (E. coli C λ-, F- wild type molecular biology strain obtained from the Department of Biochemistry and Biophysics, University of Kalyani, India, where it is maintained) grew up to log phase (optical density>0.1; optical density was measured at 600 nm wavelength by Shimadzu PharmaSpec UV-1700 spectrophotometer) with mechanical shaking at 37 ℃ in the standard Luria-Bertani (LB, 0.5% yeast extract, 1% tryptone, 1% sodium chloride and 2% bacto agar) medium and were allocated randomly to the following sets: normal control (standard LB medium), arsenite-treated 1 (LB plus 1 mmol/L sodium arsenite Ⅲ (Fluka, Switzerland)), arsenite-treated 2 (LB plus 2 mmol/L sodium arsenite), drug-treated 1 (LB plus 1 mmol/L arsenite plus Ars Alb 30C), drug-treated 2 (LB plus 2 mmol/L arsenite plus Ars Alb 30C), placebo-treated positive control 1 (LB plus 1 mmol/L sodium arsenite plus alcohol 30C), placebo-treated positive control 2 (LB plus 2 mmol/L sodium arsenite plus alcohol 30C).
     From the growth curves of different concentrations of sodium arsenite treatment (Figure 1), 1 and 2 mmol/L sodium arsenite were found to be the ideal sublethal doses for our experiments. From the control curve where no arsenite was added, it was clear that the organism retained its log phase up to 1.5 h (90 min); hence we conducted the following experiments at two time points, 45 min and 90 min, respectively, and at the doses of 1 and 2 mmol/L sodium arsenite, respectively.
1.2  Replication  Different parameters of study were conducted on three subsets of experiments each and for each subset of experiment three replicates were studied (n=9). For normalization of the data against a standard growth pattern of the bacteria, the mean values were produced.
1.3  Selection of the dose of sodium arsenite  E. coli grew up to log phase and then different doses of sodium arsenite (0 to 3.5 mmol/L) were administered in the growing medium and the optical density was measured at 600 nm wavelength at different time intervals.

Figure 1  Escherichia coli growth curve under different doses of sodium arsenite

Growth curve of Escherichia coli subjected to treatment with different doses of sodium arsenite. The doses of 1 mmol/L and 2 mmol/L were selected from this curve.

1.4  Glucose uptake measurement  Glucose uptake in E. coli of different sets was measured by Anthron’s method[10] (spectrophotometric analysis by Shimadzu PharmaSpec UV-1700) at 45 min and 90 min, respectively.
1.5  Hexokinase assay  Specific activity of hexokinase[11] in E. coli of different sets was quantified by spectrophotometric study at 45 min and 90 min, respectively.
1.6  Total ATP measurement  Total amount of ATP was measured in E. coli of different sets by luminometric study[12] carried out at 45 min and 90 min, respectively, by using Thermo-Scientific Varioskan by EnzyLight ATP assay kit.
1.7  Measurement of membrane potential by spectrofluorimetric method  The membrane potential of E. coli was determined spectrofluorimetrically by measuring the fluorescence quenching in intact cells[13] using the fluorescence dye 3,3′-diphenylthio carbocyanine iodide. The dye was not itself fluorescent, but binding of the dye to the membrane made it fluorescent. The incorporation of the dye into the intact cell membrane is known to be potential-dependent, that is, more incorporation of dye indicates more potential[14]. Thus it is possible to measure any alteration of cell membrane potential from the corresponding change in the fluorescence intensity. 2 μL of 1 mmol/L fluorescent dye was added to 3 mL of phosphate buffer saline (PBS)-diluted cell suspension and the fluorescence was measured by fluorimetric study using Thermo-Scientific Varioskan with excitation and emission at 556 nm and 575 nm, respectively, keeping both slits at 5 nm. Then the protonophore carbonyl cyanide meta chlorophenyle hydrazone (CCCP) was added to the dye-bound cells at a final concentration of 70 μmol/L and after a brief vortexing, the fluorescence was again measured as mentioned above. This addition of CCCP to the dye-bound cells caused heavy release of that dye from the cell to the extracellular medium.
     The relative membrane potential was measured at 45 min and 90 min, respectively, after addition of arsenite by using following equation: [1-(b-a)/(c-a)]×100%, where a=fluorescence intensity, b = fluorescence intensity with (cells + dye) and c = fluorescence intensity with (cells + dye + CCCP).
1.8  Measurement of the growth of E. coli cells  The growth of E. coli of different sets was quantified by spectrophotometric analysis and dilution plating method at 45 min and 90 min, respectively.
1.9  Arsenic measurement in spent medium and E. coli cells  The arsenic content[15] was determined in spent media and in E. coli cells of different sets by atomic absorption spectroscopy (AAS; Perkin-Elmer AA200, USA).
1.10  RNA isolation, complementary DNA preparation and gene level expression study by reverse transcription-polymerase chain reaction  Total RNA from E. coli cells was isolated using TRIzol reagent (a monophasic solution of phenol and guanidine isothiocyanate suitable for isolating total RNA from cells, procured from Bangalore Genei, India)[16]. To prepare complementary DNA (cDNA), 2 μg of total RNA was reverse-transcribed (RT) using oligo-dT primer up to final concentration of 100 mmol/L magnasium chloride (MgCl2), 750 mmol/L potassium chloride (KCl) and 500 mmol/L Tris(hydroxymethyl) aminomethane hydrochloride(Tris-HCl; pH 8.3), 10 mmol/L of each deoxynucleoside triphosphates (dNTPs), 20 units of ribonuclease (RNase) inhibitor and 10 units of Moloney murine leukemia virus (M-MuLV) reverse transcriptase (Chromous Biotech, India). The mixture was incubated at 37 ℃ for 1 h and reaction terminated at 95 ℃ after 2 min. Polymerase chain reaction (PCR) was performed using Taq DNA polymerase (Chromous Biotech, India) in accordance with the manufacturer’s instruction. Briefly, 5 μL of RT product (cDNA) was used in a total volume of 25 μL[16]. The primer sequences of amplified genes are shown in Table 1. PCR was performed on an automated thermal cycler (Applied Biosystems, USA). For each PCR, pre-denaturation (95 ℃ for 3 min) was necessary before the amplification cycle (35 cycles) and after reaction there was a final extension phase at 72 ℃ for 10 min. The amplified cDNA products were separated on 1.0% agarose gel electrophoresis in Tris-acetic acid ethylene diamine tetra acetic acid (TAE) buffer with 0.5 μg/mL ethidium bromide (EtBr) and visualized under ultra-violet (UV) trans-illuminator and photographed. Densitometric analysis was performed on a negative image using Image J software (Image J software is a public domain software initially produced by Richard Stallman at NIH, USA).

 

Table 1  The sequences of used primers in RT-PCR and real-time-RT-PCR

Primer name Primer sequence (5′-3′)
RT-PCR Real-time RT-PCR

G-3-PDH (house-keeping gene)

Forward: CCCACTAACATCAAATGGGG
Reverse: CCTTCCACAATGCAAAGTT

Forward: GAGAACGGGAAGCTTGTCATC
Reverse: CATGACGAACATGGGGGCATC

arsB (arsenic resistance gene)

Forward: CTGCACGTCTCACGCTGGGG
Reverse: CGGCGATATCCACCGGCACC

Forward: CCGCCAGCCTGCCGCTTATT
Reverse: CGGCGATATCCACCGGCACC

ptsG (glucose permease gene)

Forward: CGGCGCTGACCTGGTTCCTG
Reverse: ACGGAACCGCCTGCTTCTGC

Forward: ACGCTTTGTGCCGATCATTTCTGG
Reverse: AACGCAACTACCGGGTTCTGGTAA

RT-PCR: reverse transcription-polymerase chain reaction; G-3-PDH: glyceraldehyde-3-phosphate dehydrogenase.

1.11  Quantitative real-time RT-PCR  The total RNA from E. coli cells was isolated using TRIzol reagent (Bangalore Genei, India), and after preparing cDNA, quantitative PCR analysis was performed with SYBR Green Master Mix, using ABI7500 (Applied Biosystems, Inc., Foster City, CA, USA)[17]. The specific primers for arsenic resistance gene (arsB) and glucose permease gene (ptsG) were used in this study, the details of which are mentioned in Table 1. The relative gene expressions were normalized to glyceraldehyde-3-phosphate dehydrogenase (G-3-PDH, sequence provided in Table 1) using the formula: 2-ΔΔCT, where (ΔΔCT=ΔCT sample-ΔCT untreated control).
1.12  Lipid peroxidase, superoxide dismutase and catalase assay  The specific activities of lipid peroxidase (LPO)[18], superoxide dismutase (SOD)[19] and catalase[20] in E. coli of different sets were quantified by spectrophotometric study at 45 min and 90 min, respectively.
1.13  Estimation of total thiol content  For total thiol assay[21], the cell extract was added to a reaction mixture of sulfosalicylic acid, sodium phosphate buffer (pH 8.0) and double distilled water. Then 5,5′-dithiobis-2-nitrobenzoic acid (DTNB) solution was added and the absorbance was read at 412 nm by spectrophotometric method.
1.14  Estimation of intracellular ROS generation  The intracellular ROS of the experimental cells was analyzed qualitatively by a flow cytometer (BD FACS-ARIA)[22]. Cells grew up to their log phase and the accumulated ROS was determined by the flow cytometer using the 2′7′-dichloro dihydrofluorescein diacetate (DCF-DA) dye after the addition of 1 mmol/L and 2 mmol/L sodium arsenite at 45 min and 90 min, respectively. The cells were washed with PBS and then incubated for 30 min with 40 nmol/L DCF-DA in the dark. The fluorescence was observed in the green channel (FL1; 525 nm) of the flow cytometer equipped with an argon laser (488 nm) and with the standard filter set up.
1.15  Comet assay  For comet assay[23] , cells grew up to their log phase and were suspended in 0.75% low melting agarose (containing 1 mg/mL lysozyme) and were layered over a frosted microscopic slide. Then the slides were immersed in lysis buffer (pH 10) and subjected to electrophoresis in buffer (pH 13) for 20 min. Those slides were then washed with neutralizing buffer (pH 7.5), stained with ethidium bromide (1 mg/mL) and examined under a fluorescence microscope. The extent of DNA breakage was determined by measuring the comet tail length using Motic Image software (Motic Image Plus 2.0 ML software, China).
1.16  DNA gel electrophoresis  Chromosomal DNA from different sets of the control and treated cells was extracted with phenol-chloroform-isoamyl alcohol method and then was subjected to electrophoresis using 1.5% agarose gel in TAE buffer with 0.5 μg/mL ethidium bromide, visualized under UV transilluminator and photographed.
1.17  Preparation and source of Ars Alb 30C and placebo 30C  Ars Alb 30C and placebo 30C were procured from the Boiron Laboratory, Lyon, France, who prepared the drug following the standard homeopathic procedure as mentioned by Stock-Schrer et al[24]. The following procedure of homeopathic serial dilutions and agitations was followed. One gram of arsenic trioxide (As2O3) was dissolved in 100 mL 70% ethyl alcohol (that is to make it 1% As2O3), and 1 mL of the 1% As2O3 was diluted with 99 mL of 70% ethanol giving 10 mechanically uniform jerks to produce potency 1C. Then the same procedure was followed to produce potency 2C and so on.
     The observers were blinded during observation and scoring of the data. The different coded vials (containing randomized populations of E. coli) of both the experimental (containing Ars Alb 30C) and control sets (placebo of vehicle) were not known to the observers as to which one belonged to the treated or the control group. The coded vials were only deciphered later to remove any bias in observation. The same blinding method in each experiment was followed.
1.18  Statistical analysis  The data were presented as mean±standard error of mean. Statistical analysis was performed by one-way analysis of variance (using SPSS software). P<0.05 was considered significant.

  


2  Results
2.1  Glucose uptake measurement 
When E. coli was exposed to 1 mmol/L sodium arsenite, there was a significant increase in glucose uptake (μg/mL per cell) at both 45 min and 90 min compared to the negative control set. Glucose uptake was further increased at 45 min and 90 min when Ars Alb 30C was added, but not when placebo was added (Figure 2A). We obtained almost the same results when E. coli was exposed to 2 mmol/L sodium arsenite. But the rate of glucose uptake was much higher for the 2 mmol/L arsenite insult than that of the 1 mmol/L-treated one (Figure 2B).
     The overall extent of glucose uptake was found to be reduced at 90 min, indicating that the requirement for glucose uptake was reduced after certain period of time and there could be a threshold level or saturation point after which glucose uptake would decline.

Figure 2  Quantitative data of glucose uptake

Glucose uptake (μg/mL per cell) was measured in Escherichia coli cells after 45 min and 90 min, respectively. A: 1 mmol/L sodium arsenite-treated cells; B: 2 mmol/L sodium arsenite-treated cells. Glucose uptake values were measured in three independent experiments done in triplicate. Mean±standard error of mean was plotted. Significance level at *P<0.05, vs normal control and P<0.05, vs placebo-treated positive control. Ars Alb 30C: Arsenicum Album 30C.


2.2  Measurement of the specific activity of hexokinase  The specific activity of hexokinase (μmol/(L·mg·min)) in E. coli was significantly decreased both at 45 min and 90 min after addition of 1 mmol/L and 2 mmol/L sodium arsenite (Figure 3) in the medium. Specific activity of hexokinase slightly decreased in 2 mmol/L arsenite insult than in 1 mmol/L arsenite. Addition of Ars Alb 30C in the 1 mmol/L and 2 mmol/L sodium arsenite-treated medium showed significant decreases in the specific activity of hexokinase after 45 min and 90 min, respectively, as compared to that of only 1 mmol/L and 2 mmol/L sodium arsenite-treated cells. The addition of placebo to standard medium did not make any significant difference in specific activity of hexokinase measured in E. coli either at 45 min or at 90 min.

Figure 3  Data of hexokinase assay

Specific activity of hexokinase (μmol/(L·mg·min)) was measured at 45 min and 90 min, respectively, after addition of two different doses of sodium arsenite. A: 1 mmol/L sodium arsenite-treated cells; B: 2 mmol/L sodium arsenite-treated cells. The values were measured in three independent experiments done in triplicate. Mean±standard error of mean was plotted. Significance level at *P<0.05, vs normal control and P<0.05, vs placebo-treated positive control. Ars Alb 30C: Arsenium Album 30C.


2.3  Total ATP measurement in E. coli  The data of total ATP concentration in E. coli cells showed a significant decrease both at 45 min and 90 min after addition of 1 mmol/L and 2 mmol/L sodium arsenite, respectively (Figure 4). Addition of Ars Alb 30C in the 1 mmol/L and 2 mmol/L sodium arsenite-treated media showed significant increases in ATP concentration both at 45 min and 90 min, respectively, as compared to only 1 mmol/L and 2 mmol/L sodium arsenite treatments. The addition of placebo to standard medium did not make any significant difference in ATP concentration measured in E. coli either at 45 min or at 90 min. The overall concentration of ATP was found to be reduced at 90 min as compared to 45 min, indicating that the ATP was presumably degraded or else, utilized by the cell itself.

Figure 4  Intracellular ATP concentration

ATP concentration in Escherichia coli cells (μmol/L per cell) was determined at 45 min and 90 min after exposure of the cells to two different concentrations of sodium arsenite. A: 1 mmol/L sodium arsenite-treated cells; B: 2 mmol/L sodium arsenite-treated cells. Intracellular ATP concentration was measured in three independent experiments done in triplicate. Mean±standard error of mean was plotted. Significance level at *P<0.05, vs normal control and P<0.05, vs placebo-treated positive control. ATP: adenosine triphosphate; Ars Alb 30C: Arsenium Album 30C.


2.4  Assay of cell membrane potential by spectrofluorimetric method  The membrane potential in E. coli was significantly decreased both at 45 min and 90 min after addition of 1 mmol/L and 2 mmol/L sodium arsenite (Figure 5). The membrane potential decreased more in 2 mmol/L arsenite insult than in 1 mmol/L arsenite. Addition of Ars Alb 30C to the 1 mmol/L and 2 mmol/L sodium arsenite-treated cells showed significant decreases in their membrane potential after 45 min and 90 min, respectively, as compared to only 1 mmol/L and 2 mmol/L sodium arsenite treatments. Placebo did not make any significant difference in membrane potential, measured in E. coli either at 45 min or at 90 min. Decrease of membrane potential would indicate an increase in the amount of glucose uptake, namely, less membrane potential of cells would indicate more glucose uptake.

 

Figure 5  Analysis of membrane potential by spectroflurimetric method

Cell membrane potential of Escherichia coli (mV) was estimated at 45 min and 90 min after exposure of the cells to two different doses of sodium arsenite. A: 1 mmol/L sodium arsenite-treated cells; B: 2 mmol/L sodium arsenite-treated cells. Values were measured in three independent experiments done in triplicate. Mean±standard error of mean was plotted. Significance level at *P<0.05, vs normal control and P<0.05, vs placebo-treated positive control. Ars Alb 30C: Arsenium Album 30C.

2.5  Measurement of the growth of E. coli cells  The cell number of E. coli (colony-forming unit/mL) significantly decreased both at 45 min and 90 min after addition of 1 mmol/L and 2 mmol/L sodium arsenite. The cell number of E. coli again increased after the addition of Ars Alb 30C to 1 mmol/L and 2 mmol/L arsenite-intoxicated cells both at 45 min and 90 min, respectively (Figure 6). The addition of placebo to the standard medium did not make any significant difference in cell count of E. coli either at 45 min or at 90 min.

Figure 6  Growth of bacteria

Growth of Escherichia coli cells (CFU/mL) was determined at 45 min and 90 min after exposure of the cells to two different concentrations of sodium arsenite. A: 1 mmol/L sodium arsenite-treated cells; B: 2 mmol/L sodium arsenite-treated cells. Bacterial growth was measured in three independent experiments done in triplicate. Mean±standard error of mean was plotted. Significance level at *P<0.05, vs normal control and P<0.05, vs placebo-treated positive control. CFU: colony-forming unit; Ars Alb 30C: Arsenicum Album 30C.


2.6  Measurement of intracellular arsenic content  The arsenic concentration in E. coli cell was significantly increased both at 45 min and 90 min after addition of 1 mmol/L and 2 mmol/L sodium arsenite, respectively, when compared to that of control set (Figure 7). The intracellular arsenic concentration decreased significantly after the addition of Ars Alb 30C in the 1 mmol/L and 2 mmol/L sodium arsenite-treated cells, both at 45 min and 90 min, respectively, as compared to only arsenite-treated cells. The addition of placebo to the standard medium did not make any significant difference in intracellular arsenic concentration either at 45 min or at 90 min. The intracellular arsenic concentration of the 2 mmol/L arsenite-intoxicated cells was little higher than that of the 1 mmol/L arsenite-treated cells.

Figure 7  Intracellular arsenic measurement data

Arsenic content inside the cell (μg/L per cell) was determined at 45 min and 90 min after exposure of the cells to two different concentrations of sodium arsenite. A: 1 mmol/L sodium arsenite-treated cells; B: 2 mmol/L sodium arsenite-treated cells. Arsenic was measured in three independent experiments done in triplicate. Mean±standard error of mean was plotted. Significance level at *P<0.05, vs normal control and P<0.05, vs placebo-treated positive control. Ars Alb 30C: Arsenicum Album 30C.


2.7  Measurement of extracellular arsenic content  The arsenic concentration in spent medium was significantly higher both at 45 min and 90 min after addition of 1 mmol/L and 2 mmol/L sodium arsenite, respectively, as compared to that of the control set. Arsenic concentration in spent media of 2 mmol/L arsenite insult was a little higher than that of 1 mmol/L arsenite treatment. Addition of Ars Alb 30C to the 1 mmol/L and 2 mmol/L sodium arsenite-treated medium showed significant increases in the concentration of arsenic in spent medium, both at 45 min and 90 min, respectively, as compared to that of only 1 mmol/L and 2 mmol/L sodium arsenite treatments (Figure 8). The addition of placebo to the standard medium did not make any significant difference in arsenic concentration measured in spent medium either at 45 min or at 90 min. The arsenic content in the media was increased with the decrease of intracellular arsenic, along with the lapse of time.

Figure 8  Extracellular arsenic measurement data

Arsenic content in the spent medium (μg/L per cell) was determined at 45 min and 90 min after exposure of the cells to two different concentrations of sodium arsenite. A: 1 mmol/L sodium arsenite-treated cells; B: 2 mmol/L sodium arsenite-treated cells. Arsenic was measured in three independent experiments done in triplicate. Mean±standard error of mean was plotted. Significance level at *P<0.05, vs normal control and P<0.05, vs placebo-treated positive control. Ars Alb 30C: Arsenicum Album 30C.

2.8  Gene expression analysis by RT-PCR method  The expression levels of arsB (an arsenic pump, GenBank accession No. ECK3487), ptsG (GenBank accession No. ECK1087) and house-keeping gene (G-3-PDH, GenBank accession No. U82259) of E. coli cells in different control and treatment groups are summarized in Figures 9 and 10.
     The arbitrary band intensity level of arsB was significantly increased both at 45 min and 90 min after addition of 1 mmol/L and 2 mmol/L sodium arsenite. The arbitrary band intensity level increased more in 2 mmol/L arsenite insult than in 1 mmol/L arsenite. The intensity of the band was known to be expression-dependent, namely, more intense band indicates more genetic level expression.
     Addition of Ars Alb 30C to 1 mmol/L and 2 mmol/L sodium arsenite-treated cells showed significant increases in their band intensity after 45 min and 90 min, as compared to only 1 mmol/L and 2 mmol/L sodium arsenite treatments. The addition of placebo did not make any significant difference in band intensity in E. coli either at 45 min or at 90 min (Figure 9).

Figure 9  arsB expression analysis by RT-PCR

A: Arbitrary band intensities of arsB (arsenic resistance gene) were analyzed against the house-keeping gene (G-3-PDH) under different conditions. (a) and (d) represent the expression of house-keeping gene after 1 mmol/L and 2 mmol/L of sodium arsenite addition, respectively; (b) represents the expression of arsB at 45 min after the addition of 1 mmol/L arsenite; (c) represents the expression of arsB at 90 min after the addition of 1 mmol/L arsenite; (e) represents the expression of arsB at 45 min after the addition of 2 mmol/L arsenite; (f) represents the expression of arsB at 90 min after the addition of 2 mmol/L arsenite. Ln1: Control cells; Ln2: Sodium arsenite-treated cells; Ln3: Sodium arsenite plus placebo-treated cells; Ln4: Sodium arsenite plus Ars Alb 30C-treated cells.
B: Quantitative results of arsB expression with 1 mmol/L sodium arsenite exposure; C: Quantitative results of arsB expression with 2 mmol/L sodium arsenite exposure. Bars represent average values of intensity. Values were measured in three independent experiments done in triplicate. Mean±standard error of mean was plotted. Significance level at *P<0.05, vs normal control and P<0.05, vs placebo-treated positive control. RT-PCR: reverse transcription-polymerase chain reaction; G-3-PDH: glyceraldehyde-3-phosphate dehydrogenase; Ars Alb 30C: Arsenicum Album 30C.


     The arbitary band intensity level of ptsG in the cells significantly increased after addition of 1 mmol/L and 2 mmol/L sodium arsenite to the media. The arbitary band intensity level increased more in 2 mmol/L arsenite insult than in 1 mmol/L arsenite. The intensity of the band is known to be expression-dependent, namely, more intense band indicates more genetic level expression.
     Addition of Ars Alb 30C to the 1 mmol/L and 2 mmol/L sodium arsenite-treated cells showed significant increases in their band intensity as compared to only 1 mmol/L and 2 mmol/L sodium arsenite treatments but the addition of placebo did not make any significant difference in band intensity in E. coli (Figure 10).


Figure 10  ptsG expression analysis by RT-PCR

A: Arbitrary band intensities of ptsG (glucose permease gene) were analyzed against the house-keeping gene (G-3-PDH) under different conditions. (a) and (c) represent the expression of house-keeping gene after 1 mmol/L and 2 mmol/L of sodium arsenite addition, respectively; (b) represents the expression of ptsG after the addition of 1 mmol/L arsenite; (d) represents the expression of ptsG after the addition of 2 mmol/L arsenite. Ln1: Control cells; Ln2: Sodium arsenite-treated cells; Ln3: Sodium arsenite plus Ars Alb 30C-treated cells; Ln4: Sodium arsenite plus placebo-treated cells.
B: Quantitative results of ptsG expression with 1 mmol/L sodium arsenite exposure; C: Quantitative results of ptsG expression with 2 mmol/L sodium arsenite exposure. Bars represent average values of intensity. Values were measured in three independent experiments done in triplicate. Mean±standard error of mean was plotted. Significance level at *P<0.05, vs normal control and P<0.05, vs placebo-treated positive control. RT-PCR: reverse transcription-polymerase chain reaction; G-3-PDH: glyceraldehyde-3-phosphate dehydrogenase; Ars Alb 30C: Arsenicum Album 30C.


2.9  Gene expression analysis by quantitative real-time RT-PCR  The relative gene expressions of arsB (normalized by house-keeping gene G-3-PDH) of E. coli cells in different control and treatment groups are summarized in Figure 11. The relative gene expression level was significantly increased both at 45 min and 90 min after addition of 1 mmol/L and 2 mmol/L sodium arsenite. Expression level increased more in 2 mmol/L sodium arsenite-treated bacteria than in 1 mmol/L sodium arsenite-treated cells. Addition of Ars Alb 30C to 1 mmol/L and 2 mmol/L sodium arsenite-treated cells showed significant increases in their relative genetic expression after 45 min and 90 min, respectively, as compared to only 1 mmol/L and 2 mmol/L sodium arsenite treatments. All expressions were measured against control cells (taking the expression of control cells as unit). Addition of placebo did not make any significant difference in gene expression in E. coli either at 45 min or at 90 min.

Figure 11  arsB expression tested by quantitative real-time RT-PCR

Quantitative real-time RT-PCR analysis of arsB (arsenic resistance gene) was measured at 45 min and 90 min, respectively, after addition of two different doses of sodium arsenite. A: 1 mmol/L sodium arsenite-treated cells; B: 2 mmol/L sodium arsenite-treated cells. The values were measured in three independent experiments done in triplicate. Mean ± standard error of mean was plotted. Significance level at *P<0.05, vs normal control and P<0.05, vs placebo-treated positive control. RT-PCR: reverse transcription-polymerase chain reaction; Ars Alb 30C: Arsenicum Album 30C.


     The relative gene expressions of ptsG (normalized by house-keeping gene G-3-PDH) of E. coli cells in different control and treatment groups are summarized in Figure 12. The relative gene expression level significantly increased after addition of 1 mmol/L and 2 mmol/L sodium arsenite to the media. Expression level increased more in 2 mmol/L sodium arsenite-treated bacteria than in 1 mmol/L sodium arsenite-treated cells. Addition of Ars Alb 30C to the 1 mmol/L and 2 mmol/L sodium arsenite-treated cells showed significant increases in their relative genetic expression, as compared to only 1 mmol/L and 2 mmol/L sodium arsenite treatments. All expressions were measured against control cells (taking the expression of control cells as unit).

 

Figure 12  ptsG expression tested by quantitative real-time RT-PCR

Quantitative real-time RT-PCR analysis of ptsG (glucose permease gene) was measured after addition of two different doses of sodium arsenite. A: 1 mmol/L sodium arsenite-treated cells; B: 2 mmol/L sodium arsenite-treated cells. The values were measured in three independent experiments done in triplicate. Mean±standard error of mean was plotted. Significance level at *P<0.05, vs normal control and P<0.05, vs placebo-treated positive control. RT-PCR: reverse transcription-polymerase chain reaction; Ars Alb 30C: Arsenicum Album 30C.

2.10  Measurement of specific activity of LPO  The specific activities of LPO in the control and treatment groups are summarized in Figure 13. LPO in E. coli cells significantly increased after addition of 1 mmol/L and 2 mmol/L sodium arsenite at both 45 min and 90 min, respectively. Addition of Ars Alb 30C to 1 mmol/L and 2 mmol/L sodium arsenite-treated cells showed significant decreases in LPO after 45 min and 90 min, respectively, as compared to only 1 mmol/L and 2 mmol/L sodium arsenite treatments. The addition of placebo did not make any significant difference in LPO in E. coli either at 45 min or at 90 min.

Figure 13  Assay of lipid peroxidation

Specific activity of lipid peroxidase (μmol/(L·mg·min)) was measured at 45 min and 90 min, respectively, after addition of two different doses of sodium arsenite to the media. A: 1 mmol/L sodium arsenite-treated cells; B: 2 mmol/L sodium arsenite-treated cells. The values were measured in three independent experiments done in triplicate. Mean±standard error of mean was plotted. Significance level at *P<0.05, vs normal control and P<0.05, vs placebo-treated positive control. Ars Alb 30C: Arsenicum Album 30C.

2.11  Measurement of specific activity of catalase  The specific activities of catalase in the control and treatment groups are summarized in Figure 14. Catalase in E. coli cells significantly decreased after addition of 1 mmol/L and 2 mmol/L sodium arsenite at both 45 min and 90 min, respectively. Addition of Ars Alb 30C to the 1 mmol/L and 2 mmol/L sodium arsenite-treated cells showed significant increases in catalase activity after 45 min and 90 min, respectively, as compared to only 1 mmol/L and 2 mmol/L sodium arsenite treatments. The addition of placebo did not make any significant difference in specific activity of catalase in E. coli either at 45 min or 90 min.

Figure 14  Catalase assay data

Specific activity of catalase (μmol/(L·mg·min)) was measured at 45 min and 90 min, respectively, after addition of two different doses of sodium arsenite. A: 1 mmol/L sodium arsenite-treated cells; B: 2 mmol/L sodium arsenite-treated cells. The values were measured in three independent experiments done in triplicate. Mean±standard error of mean was plotted. Significance level at *P<0.05, vs normal control and P<0.05, vs placebo-treated positive control. Ars Alb 30C: Arsenicum Album 30C.


2.12  Measurement of the specific activity of SOD  The specific activities of SOD in the control and treatment groups are summarized in Figure 15. SOD in E. coli cells significantly decreased after addition of 1 mmol/L and 2 mmol/L sodium arsenite at both 45 min and 90 min, respectively. Addition of Ars Alb 30C to the 1 mmol/L and 2 mmol/L sodium arsenite-treated cells showed significant increases in SOD activity after 45 min and 90 min, respectively, as compared to only 1 mmol/L and 2 mmol/L sodium arsenite treatments. The addition of placebo did not make any significant difference in specific activity of SOD in E. coli either at 45 min or at 90 min.

 

Figure 15  Superoxide dismutase assay data

Specific activity of superoxide dismutase (μmol/(L·mg)) was measured at 45 min and 90 min, respectively, after addition of two different doses of sodium arsenite. A: 1 mmol/L sodium arsenite-treated cells; B: 2 mmol/L sodium arsenite-treated cells. The values were measured in three independent experiments done in triplicate. Mean±standard error of mean was plotted. Significance level at *P<0.05, vs normal control and P<0.05, vs placebo-treated positive control. Ars Alb 30C: Arsenicum Album 30C.

2.13  Intracellular glutathione content  The amounts of intracellular glutathione (GSH) (free GSH to react with salicylic acid and DTMB and give absorbance at 412 nm) are presented in Figure 16. The concentration of free GSH in E. coli cells significantly decreased both at 45 min and 90 min after addition of 1 mmol/L and 2 mmol/L sodium arsenite treatment. Addition of Ars Alb 30C to the 1 mmol/L and 2 mmol/L sodium arsenite-treated cells showed significant increases in GSH concentration both at 45 min and 90 min, respectively, compared to only 1 mmol/L and 2 mmol/L sodium arsenite treatments. The addition of placebo did not make any significant difference in intracellular glutathione concentration either at 45 min or at 90 min.

Figure 16  Intracellular glutathione concentration data

Intracellular glutathione concentration in Escherichia coli cells (μmol/L per 108 cells) was determined at 45 min and 90 min after exposure of the cells to two different concentrations of sodium arsenite. A: 1 mmol/L sodium arsenite-treated cells; B: 2 mmol/L sodium arsenite-treated cells. Intracellular glutathione concentrations were measured in three independent experiments done in triplicate. Mean±standard error of mean was plotted. Significance level at *P<0.05, vs normal control and P<0.05, vs placebo-treated positive control. Ars Alb 30C: Arsenicum Album 30C.

2.14  Intracellular ROS measurement by flow cytometry  The generation of ROS was minimum in normal cells, namely, the value of ROS generation was the lowest in control cells both in 45 min (1.5%) and 90 min (4.3%). The ROS values were increased in 1 mmol/L and 2 mmol/L sodium arsenite-treated cells both at 45 min and 90 min, respectively. That result depicts the increase of ROS after the addition of sodium arsenite. Addition of 2 mmol/L sodium arsenite produced more ROS generation than 1 mmol/L sodium arsenite treatment. Addition of Ars Alb 30C to the 1 mmol/L and 2 mmol/L sodium arsenite-treated cells showed significant decreases in ROS generation both at 45 min and 90 min, compared to only 1 mmol/L and 2 mmol/L sodium arsenite treatments. The addition of placebo did not make any significant difference in intracellular ROS generation either at 45 min or at 90 min.
2.15  DNA damage by comet assay  The DNA damage in different control and treatment groups is summarized in Figure 17. The comet tail length was the minimum in control cells. This indicates that the level of DNA damage in control sets was minimum (more comet tail length means more DNA damage). The comet tail lengths also increased after the addition of 1 mmol/L and 2 mmol/L sodium arsenite at both 45 min and 90 min. Addition of Ars Alb 30C to 1 mmol/L and 2 mmol/L sodium arsenite-treated cells showed significant decreases in comet tail length both at 45 min and 90min, as compared to only 1 mmol/L and 2 mmol/L sodium arsenite treatments. This indicates that the drug resisted the DNA damage, which was affected by the arsenic effect. The addition of placebo did not make any difference in intracellular comet tail length either at 45 min or at 90 min.

 

Figure 17  DNA damage analysis by comet assay

A: Photographs showing the DNA damage by comet assay. (a) and (h) represent the control cells after 1 mmol/L and 2 mmol/L of sodium arsenite addition, respectively; (b) 45 min after the addition of 1 mmol/L sodium arsenite; (c) 45 min after the addition of 1 mmol/L sodium arsenite and placebo; (d) 45 min after the addition of 1 mmol/L sodium arsenite and Ars Alb 30C; (e) 90 min after the addition of 1 mmol/L sodium arsenite; (f) 90 min after the addition of 1 mmol/L sodium arsenite and placebo; (g) 90 min after the addition of 1 mmol/L sodium arsenite and Ars Alb 30C; (i) 45 min after the addition of 2 mmol/L sodium arsenite; (j) 45 min after the addition of 2 mmol/L sodium arsenite and placebo; (k) 45 min after the addition of 2 mmol/L sodium arsenite and Ars Alb 30C; (l) 90 min after the addition of 2 mmol/L sodium arsenite; (m) 90 min after the addition of 2 mmol/L sodium arsenite and placebo; (n) 90 min after the addition of 2 mmol/L sodium arsenite and Ars Alb 30C.
B: Quantitative results of 1 mmol/L sodium arsenite exposure. C: Quantitative results of 2 mmol/L sodium arsenite exposure. Bars represent average values of comet tail lengths. Values were measured in three independent experiments done in triplicate. Mean±standard error of mean was plotted. Significance level at *P<0.05, vs normal control and P<0.05, vs placebo-treated positive control.

2.16  DNA gel electrophoresis  Figure 18 represents the agarose gel electrophoresis data of different control and treated groups of E. coli genomic DNA. It was observed that both concentrations (1 mmol/L and 2 mmol/L sodium arsenite) of arsenite-exposed cells showed a smear (smear indicates DNA fragmentation) when DNA was isolated and electrophoresed on 1% agarose gel, whereas control cells showed an intense single band rather than smear. Addition of Ars Alb 30C to the 1 mmol/L and 2 mmol/L sodium arsenite-treated cells showed comparatively less smear than only 1 mmol/L and 2 mmol/L sodium arsenite treatments. This result indicates that the drug could resist DNA breakage, which was caused by the arsenic effect. The addition of placebo did not make any changes in DNA gel pattern as compared to 1 mmol/L and 2 mmol/L sodium arsenite treatments.

Figure 18  DNA gel electrophoresis

Images of DNA gel after electrophoresis containing DNA samples of different treatments. A: 1 mmol/L sodium arsenite-treated cells, (B) 2 mmol/L sodium arsenite-treated cells. Ln1: Control cells; Ln2: Sodium arsenite-treated cells; Ln3: Sodium arsenite plus placebo-treated cells; Ln4: Sodium arsenite plus Ars Alb 30C-treated cells.

2.17  Homogeneity of placebo control  The spectrophotometric data (not shown) of placebo controls (set 1, set 2 and set 3 — collected in three different cuvettes at both 45 min and 90 min) represented almost the same absorbance value, measured at 600 nm wavelength. This result reflectes the homogeneity of the placebo controls.

  


3  Discussion
    
From the results of this study, it appears that Ars Alb 30C demonstrated its ability to modulate several parameters as compared to the placebo. First, Ars Alb 30C-treated E. coli had lesser amount of intracellular arsenic than in both the sodium arsenite-treated and placebo-treated intoxicated groups. However, when we compared the data between Ars Alb 30C and glucose 30C-treated E. coli[7], the intracellular arsenic content was found to be higher in the glucose 30C-treated E. coli. When the permease activity was compared, it was less up-regulated in the Ars Alb 30C-exposed bacteria, as compared to the glucose 30C-exposed groups. This would imply that Ars Alb 30C actively inhibited the entry of arsenic while glucose 30C apparently facilitated the entry of glucose for augmenting the synthesis of ATP. This can also explain the lesser amount of ROS generation encountered in the Ars Alb 30C-treated bacteria, as compared to the only sodium arsenite-treated and the placebo-treated groups. The lesser amount of DNA damage as revealed from both DNA ladder study and comet assay in the Ars Alb 30C-treated bacteria, as compared to the sodium arsenite-treated groups and the placebo-treated intoxicated groups, is also very significant. On the one hand, it would suggest that Ars Alb 30C induced the cells to prevent the arsenic entry into the cells by down-regulating the membrane potential, and it also triggered the activity of the arsB gene, the product of which is known to increase the resistance of E. coli to arsenic. This greater resistance was probably manifested in the higher level of survivability of E. coli in the drug-treated group, as compared to both the sodium arsenite-treated groups as well as in the placebo-treated intoxicated groups. On the other hand, glucose 30C-treated bacteria showed the ability of expelling greater amount of arsenic, but the survivability was still a little lower. The expression of ptsG in the glucose 30C-treated cells was up-regulated, facilitating more glucose uptake[7]. Thus, glucose 30C was mainly doing the job of greater glucose uptake to augment ATP synthesis, which was necessary for more arsenic expulsion, while Ars Alb 30C apparently was more involved in preventing entry of arsenic within the cell by down-regulating the permease activity and also increased the tolerance level of the bacteria by over expressing the arsB. Overall, Ars Alb 30C reduced the activity of biomarker like LPO, and increased activities of SOD and catalase and free intracellular GSH content.
     Environmental agents like arsenic induce oxidative stress that generates intracellular ROS and free radicals and alters levels of antioxidants[25,26]. The highly toxic superoxide anion (O-2) seriously disrupts normal metabolism through oxidative damage to cellular components. Oxygen free radicals can also be converted to reactive hydroxyl radicals, which cause DNA damage. Intracellular ROS, attack both the bases and the sugar moieties, producing single and double-strand breaks in the backbone, adducts of base and sugar groups and cross-links to other molecules that block replication[27,28]. Therefore, elimination of superoxide anion is definitely necessary for survival of cells[29].
     SOD, as part of the defense systems against oxidative damage in aerobic organisms[30-34], catalyzes O-2 to oxygen (O2) and hydrogen peroxide (H2O2), which then gets reduced to water (H2O) by H2O2 -scavenging enzyme, catalase[35]. Therefore, SOD and catalase are the weapons to restrict the accumulation of ROS. Some molecules like ascorbic acid and GSH are constitutively present and help to maintain an intracellular reducing environment or to scavenge reactive oxygen and protect from the attack of ROS[36].
     Results on the growth curve showed that the treatment with Ars Alb 30C increased the growth as compared to the arsenine-intoxicated E. coli. This would render additional support that this homeopathic remedy apparently enhanced the survivability level by reducing arsenic toxicity through making entry of arsenic into the bacteria difficult by manipulating membrane potential and increasing resistance through up-regulation of the arsB expression. On the other hand, overall data would tempt one to suspect that glucose 30C tended to facilitate entry of glucose (more ptsG expression) to provide the additional energy needed to expel arsenic from within the cell. Ars Alb 30C also reduced ROS generation and DNA damage apart from up-regulating expression of the resistance gene, arsB.
     Since Ars Alb 30C was diluted far beyond the Avogadro’s limit (the dilutions being 10-60), it is highly improbable that it contained even a single molecule of their initial drug substance other than the possible presence of some nanoparticles[1]. However, when we checked for the presence of any arsenic molecule in Ars Alb 30C by AAS analysis (Perkin-Elmer AA200, USA), arsenic was found at a level below the detectable range of AAS. But what is so exciting about the results is that E. coli apparently showed differential responses to two ultra-highly diluted homeopathic drugs, glucose 30C and Ars Alb 30C, implicating their ability to differentiate between these two ultra-highly diluted remedies and to act differentially in response to these two potentized drugs. Incidentally, Rey[37,38] produced evidences through his famous thermoluminisence experiments that ultradilutions could keep their initial specific properties intact. Further, these two remedies caused gene inductions in such a way which would be more fruitful in rendering protection to the organisms during arsenic stress in two different ways. It is difficult to explain if E. coli had differential receptor activities for the different ultra-highly diluted homeopathic remedies, but one thing seems clear that one of the main pathways of action was by regulating expression of the relevant genes, presumably at the direct initiative or influence of the ultra-highly diluted remedy, as the corresponding placebo could not elicit such responses. Therefore, the advocated gene-regulatory hypothesis[39-47] that the ultra-highly diluted homeopathic drugs have the ability to trigger specific genes into action seems to be quite plausible. According to this hypothesis, homeopathic remedies carry specific signals or information that can be identified by specific receptors of the cells. These signals can act as a trigger for turning “on” or “off” some relevant genes, initiating a cascade of gene actions to alter and correct the gene expressions that went wrong to produce the disorder or disease. In higher forms, the administration of a potentized homeopathic drug can elicit responses through suitable signal proteins and can either up-regulate or down-regulate such signal proteins to bring back the recovery of the patient to normal health[48]. However, in higher eukaryotes like mammals, the regulation of gene expression is a very complex phenomenon and it involves several multicellular organ systems that also need to be accounted for mind-body interaction and for the similar principle of drug action. Hameroff[49] has proposed that microtubules in our brain are the seat of our conscious mind and consist of quantum microswitches (protein qubits), which contain “pure” ordered water. These authors further suggested that microtubules interconnect every cell in a multicellular organism, possibly being the means to extend the brain’s consciousness throughout the entire body and thereby making it possible for the genes to be switched “on” or “off” in a chain reaction.
     On the other hand, in a prokaryotic model, these complexities can be avoided and a more direct cause-effect relationship can be established by delineating certain accompanying biochemical and gene-regulatory changes to understand the molecular mechanism of the biological action of the potentized homeopathic drugs. Since, a hypothesis accounting for the molecular mechanism also demands a universality in its application in all forms of organism, both higher and lower, and since the present study shows that the potentized homeopathic drugs very clearly modulated expressions of certain genes in the simple unicellular prokaryotic organism, having no central or autonomic nervous system, this working hypothesis of Khuda-Bukhsh[39-42] presents some very interesting and critical features of its own. Incidentally, a unicellular eukaryote, Saccharomyces cerevisae, exposed to arsenic stress has also been reported to respond to the homeopathic Ars Alb 30C resulting in some biochemical changes through altered expressions of certain relevant genes[50]. Therefore, this hypothesis needs to be further tested by independent workers using organisms with a simple genetic system, as well as in higher forms with advanced methodologies for pinpointing any change in gene expression patterns after administration of potentized homeopathic remedies against suitable placebo controls.

  


4  Acknowledgements
    
This work was financially supported by a grant sanctioned to Prof. Khuda-Bukhsh AR, Department of Zoology, University of Kalyani, India by the Boiron Laboratory, Lyon, France. We extend our sincere thanks to Dr. Belon P, Ex-Director, Boiron Laboratory, for providing us the homeopathic Ars Alb 30C and the placebo. We are also thankful to Dr. Mamata Chawla Sarkar and Mr. Parikshit Bagchi, Department of Virology, NICED, India and Dr. Samir Kumar Mukherjee and Mr. Arghya Bandyopadhyay, Department of Microbiology, University of Kalyani, India for permitting us to use their laboratory for conducting a part of the work. We are thankful to Dr. Das PK, Former Director, Central Vector Control Research Center, Puducherry, India for critically going through the manuscript and giving valuable suggestions.

  


5  Competing interests
    
The authors declare that they have no competing interests.

  
References
1. Chikramane PS, Suresh AK, Bellare JR, Govind S. Extreme homeopathic dilutions remain starting materials: a nanoparticulate perspective[J]. Homeopathy, 2010, 99(4) : 231-242.
    
2. Vickers AJ, Fisher P, Smith C, Wyllie SE, Rees R. Homeopathic Arnica 30× is ineffective for muscle soreness after long-distance running: a randomized, double-blind, placebo-controlled trial[J]. Clin J Pain, 1998, 14(3) : 227-231.
    
3. Lewith GT, Watkins AD, Hyland ME, Shaw S, Broomfield JA, Dolan G, Holgate ST. Use of ultramolecular potencies of allergen to treat asthmatic people allergic to house dust mite: double blind randomised controlled clinical trial[J]. BMJ, 2002, 324(7336) : 520.
    
4. Ernst E. A systematic review of systematic reviews of homeopathy[J]. Br J Clin Pharmacol, 2002, 54(6) : 577-582.
    
5. Shang A, Huwiler-Müntener K, Nartey L, Jüni P, Drig S, Sterne JA, Pewsner D, Egger M. Are the clinical effects of homoeopathy placebo effects? Comparative study of placebo-controlled trials of homoeopathy and allopathy[J]. Lancet, 2005, 366(9487) : 726-732.
    
6. House of Commons Science and Technology Committee. Evidence check 2: homeopathy. Fourth report of session 2009-10: Report, together with formal minutes, oral and written evidence. London: The Stationery Office Limited. 2010.
7. Khuda-Bukhsh AR, De A, Das D, Dutta S, Boujedaini N. Analysis of the capability of ultra-highly diluted glucose to increase glucose uptake in arsenite-stressed bacteria Escherichia coli. J Chin Integr Med. 2011; 9(8): 901-912. English with abstract in Chinese.
  
8. Lewin B. Genes Ⅷ. Upper Saddle River: Pearson Prentice Hall Pearson Education, Inc. 2004.
9. Silver S, Budd K, Leahy KM, Shaw WV, Hammond D, Novick RP, Willsky GR, Malamy MH, Rosenberg H. Inducible plasmid-determined resistance to arsenate, arsenite, and antimony (Ⅲ) in[J]. J Bacteriol, 1981, 146(3) : 983-996.
  
10. Mokrasch LC. Analysis of hexose phosphates and sugar mixtures with the anthrone reagent[J]. J Biol Chem, 1954, 208(1) : 55-59.
  
11. Racker E. Spectrophotometric measurement of hexokinase and phosphohexokinase activity[J]. J Biol Chem, 1947, 167(3) : 843-854.
  
12. Kangas L, Grnroos M, Nieminen AL. Bioluminescence of cellular ATP: a new method for evaluating cytotoxic agents in vitro[J]. Med Biol, 1984, 62(6) : 338-343.
  
13. O’Keefe D, Collier RJ. Cloned diphtheria toxin within the periplasm of Escherichia coli causes lethal membrane damage at low pH[J]. Proc Natl Acad Sci U S A, 1989, 86(1) : 343-346.
    
14. Amor KB, Breeuwer P, Verbaarschot P, Rombouts FM, Akkermans AD, De Vos WM, Abee T. Multiparametric flow cytometry and cell sorting for the assessment of viable, injured, and dead bifidobacterium cells during bile salt stress[J]. Appl Environ Microbiol, 2002, 68(11) : 5209-5216.
    
15. Behari JR, Prakash R. Determination of total arsenic content in water by atomic absorption spectroscopy (AAS) using vapour generation assembly (VGA)[J]. Chemosphere, 2006, 63(1) : 17-21.
    
16. Chowdhury R, Dutta A, Chaudhuri SR, Sharma N, Giri AK, Chaudhuri K. In vitro and in vivo reduction of sodium arsenite induced toxicity by aqueous garlic extract[J]. Food Chem Toxicol, 2008, 46(2) : 740-751.
    
17. Bagchi P, Dutta D, Chattopadhyay S, Mukherjee A, Halder UC, Sarkar S, Kobayashi N, Komoto S, Taniguchi K, Chawla-Sarkar M. Rotavirus nonstructural protein 1 suppresses virus-induced cellular apoptosis to facilitate viral growth by activating the cell survival pathways during early stages of infection[J]. J Virol, 2010, 84(13) : 6834-6845.
    
18. Buege JA, Aust SD. Microsomal lipid peroxidation[J]. Methods Enzymol, 1978, 52: 302-310.
    
19. Kakkar P, Das B, Viswanathan PN. A modified spectrophotometric assay of superoxide dismutase[J]. Indian J Biochem Biophys, 1984, 21(2) : 130-132.
  
20. Chance B, Maehly AC. Assay of catalases and peroxidases[J]. Methods Enzymol, 1955, 2: 764-775.
  [ScienceDirect]  
21. Sedlak J, Lindsay RH. Estimation of total, protein-bound, and nonprotein sulfhydryl groups in tissue with Ellman’s reagent[J]. Anal Biochem, 1968, 25(1) : 192-205.
    
22. Dhiman R, Kathania M, Raje M, Majumdar S. Inhibition of bfl-1/A1 by siRNA inhibits mycobacterial growth in THP-1 cells by enhancing phagosomal acidification[J]. Biochim Biophys Acta, 2008, 1780(4) : 733-742.
    
23. Dhawan A, Mathur N, Seth PK. The effect of smoking and eating habits on DNA damage in Indian population as measured in the comet assay[J]. Mutat Res, 2001, 474(1-2) : 121-128.
    
24. Stock-Schrer B, Albrecht H, Betti L, Dobos G, Endler C, Linde K, Lüdtke R, Musial F, van Wijk R, Witt C, Baumgartner S. Reporting experiments in homeopathic basic research — description of the checklist development. Evid Based Complement Alternat Med. 2009 Nov 1. [Epub ahead of print]
  
25. Suntres ZE. Role of antioxidants in paraquat toxicity[J]. Toxicology, 2002, 180(1) : 65-77.
    
26. Lü Z, Min H, Xia Y. The response of Escherichia coli, Bacillus subtilis, and Burkholderia cepacia WZ1 to oxidative stress of exposure to quinclorac[J]. J Environ Sci Health B, 2004, 39(3) : 431-441.
  
27. Sies H, Menck CF. Singlet oxygen induced DNA damage[J]. Mutat Res, 1992, 275(3-6) : 367-375.
  
28. Sies H. Damage to plasmid DNA by singlet oxygen and its protection[J]. Mutat Res, 1993, 299(3-4) : 183-191.
    
29. Yao XH, Min H, Lv ZM. Response of superoxide dismutase, catalase, and ATPase activity in bacteria exposed to acetamiprid[J]. Biomed Environ Sci, 2006, 19(4) : 309-314.
  
30. Imlay JA, Chin SM, Linn S. Toxic DNA damage by hydrogen peroxide through the Fenton reaction in vivo and in vitro[J]. Science, 1988, 240(4852) : 640-642.
    
31. Imlay JA, Linn S. DNA damage and oxygen radical toxicity[J]. Science, 1988, 240(4857) : 1302-1309.
    
32. Chen JR, Weng CN, Ho TY, Cheng IC, Lai SS. Identification of the copper-zinc superoxide dismutase activity in Mycoplasma hyopneumoniae[J]. Vet Microbiol, 2000, 73(4) : 301-310.
    
33. Lehmann Y, Meile L, Teuber M. Rubrerythrin from Clostridium perfringens: cloning of the gene, purification of the protein, and characterization of its superoxide dismutase function[J]. J Bacteriol, 1996, 178(24) : 7152-7158.
  
34. Gerlach D, Reichardt W, Vettermann S. Extracellular superoxide dismutase from Streptococcus pyogenes type 12 strain is manganese-dependent[J]. FEMS Microbiol Lett, 1998, 160(2) : 217-224.
    
35. Jung S. Expression level of specific isozymes of maize catalase mutants influences other antioxidants on norflurazon-induced oxidative stress[J]. Pestic Biochem Physiol, 2003, 75(1-2) : 9-17.
  [Sciencedirect]  
36. Cabiscol E, Tamarit J, Ros J. Oxidative stress in bacteria and protein damage by reactive oxygen species[J]. Int Microbiol, 2000, 3(1) : 3-8.
  
37. Rey L. Thermoluminescence of ultra-high dilutions of lithium chloride and sodium chloride[J]. Physica A, 2003, 323: 67-74.
  [ScienceDirect]  
38. Rey L. Can low-temperature thermoluminescence cast light on the nature of ultra-high dilutions?[J]. Homeopathy, 2007, 96(3) : 170-174.
    
39. Khuda-Bukhsh AR. Potentized homoeopathic drugs act through regulation of gene-expression: a hypothesis to explain their mechanism and pathways of action in vitro[J]. Complement Ther Med, 1997, 5(1) : 43-46.
  [ScienceDirect]  
40. Khuda-Bukhsh AR. Expression level of specific isozymes of maize catalase mutants influences other antioxidants on nonflurazon-induced oxydative stress[J]. Mol Cell Biochem, 2003, 253(1-2) : 339-345.
    
41. Khuda-Bukhsh AR. Laboratory research in homeopathy: pro[J]. Integr Cancer Ther, 2006, 5(4) : 320-332.
    
42. Khuda-Bukhsh AR. Mice as a model for homeopathy research[J]. Homeopathy, 2009, 98(4) : 267-279.
    
43. Khuda-Bukhsh AR, Pathak S. Homeopathic drug discovery: theory update and methodological aspect[J]. Expert Opin Drug Discov, 2008, 3(8) : 979-990.
[informa]    
44. Bhattacharyya SS, Paul S, Mandal SK, Banerjee A, Boujedaini N, Khuda-Bukhsh AR. A synthetic coumarin (4-methyl-7 hydroxy coumarin) has anti-cancer potentials against DMBA-induced skin cancer in mice[J]. Eur J Pharmacol, 2009, 614(1-3) : 128-136.
    
45. Mallick P, Mallick JC, Guha B, Khuda-Bukhsh AR. Ameliorating effect of microdoses of a potentized homeopathic drug, Arsenicum Album, on arsenic-induced toxicity in mice[J]. BMC Complement Altern Med, 2003, 3: 7.
    
46. Banerjee A, Pathak S, Biswas SJ, Roy-Karmakar S, Boujedaini N, Belon P, Khuda-Bukhsh AR. Chelidonium majus 30C and 200C in induced hepato-toxicity in rats[J]. Homeopathy, 2010, 99(3) : 167-176.
    
47. Pathak S, Kumar Das J, Jyoti Biswas S, Khuda-Bukhsh AR. Protective potentials of a potentized homeopathic drug, Lycopodium-30, in ameliorating azo dye induced hepatocarcinogenesis in mice[J]. Mol Cell Biochem, 2006, 285(1-2) : 121-131.
    
48. Khuda-Bukhsh AR, Bhattacharyya SS, Paul S, Dutta S, Boujedaini N, Belon P. Modulation of signal proteins: a plausible mechanism to explain how a potentized drug secale cor 30C diluted beyond Avogadro’s limit combats skin papilloma in mice. Evid Based Complement Alternat Med. 2009 Jul 16. [Epub ahead of print]
  
49. Center of Conciousness Studies, The University of Arizona. Proceedings of the eighteenth annual international, interdisciplinary conference on the fundamental question of how the brain produces conscious experience. Stockholm, Sweden, May 3-7, 2011.
50. Das D, De A, Dutta S, Biswas R, Boujedaini N, Khuda-Bukhsh AR. Potentized homeopathic drug Arsenicum Album 30C positively modulates protein biomarkers and gene expressions in Saccharomyces cerevisae exposed to arsenate[J] J Chin Integr Med, 2011, 9(7) : 752-760. Chinese.
  
  
This article has been cited by other articles ( Within JCIM & JIM )
1. Phenotypic evidence of ultra-highly diluted homeopathic remedies acting at gene expression level: a novel probe on experimental phage infectivity in bacteria. 2012, 10(4)
2. Ethanolic extract of Thuja occidentalis blocks proliferation of A549 cells and induces apoptosis in vitro. 2012, 10(12)

Reader's comments
1. Hq81Uc http://www.FyLitCl7Pf7kjQdDUOLQOuaxTXbj5iNG.com (2016-10-15 0:00:00)
2. Hq81Uc http://www.FyLitCl7Pf7kjQdDUOLQOuaxTXbj5iNG.com (2016-10-15 0:00:00)

Send a comment

 Home | Current Issue | Past Issues | SearchRSS
Copyright © 2013-2018 by JIM Editorial Office. All rights reserved. ISSN 2095-4964; CN 31-2083/R. 沪ICP备110264号