Updated Tuesday, September 26, 2017
JCIM & JIM
Open Access
THIS ARTICLE
-  Abstract
-  Full text
-  Download PDF file
-  Send to a friend
-  Related articles in JCIM & JIM
-  Cited in JCIM & JIM
-  Reader's comments
-  Send a comment
 Language Polishing
Original Experimental Research
Journal of Chinese Integrative Medicine: Volume 10, 2012   Issue 3
Potential of the homeopathic remedy, Arnica Montana 30C, to reduce DNA damage in Escherichia coli exposed to ultraviolet irradiation through up-regulation of nucleotide excision repair genes
1. Sreemanti Das (Cytogenetics and Molecular Biology Laboratory, Department of Zoology, University of Kalyani, Kalyani 741235, India )
2. Santu Kumar Saha (Cytogenetics and Molecular Biology Laboratory, Department of Zoology, University of Kalyani, Kalyani 741235, India )
3. Arnab De (Cytogenetics and Molecular Biology Laboratory, Department of Zoology, University of Kalyani, Kalyani 741235, India )
4. Durba Das (Cytogenetics and Molecular Biology Laboratory, Department of Zoology, University of Kalyani, Kalyani 741235, India )
5. Anisur Rahman Khuda-Bukhsh (Cytogenetics and Molecular Biology Laboratory, Department of Zoology, University of Kalyani, Kalyani 741235, India E-mail: khudabukhsh_48@rediffmail.com)
OBJECTIVE: To examine to what degree an ultra-highly diluted homeopathic remedy, Arnica Montana 30C (AM-30C), used in the treatment of shock and injury, can modulate the expression of nucleotide excision repair genes in Escherichia coli exposed to ultraviolet (UV) irradiation.
METHODS: E. coli were cultured to their log phase in a standard Luria-Bertani medium and then exposed to sublethal doses of UV irradiation at 25 and 50 J/m2 for 22.5 and 45 s, respectively. The UV-exposed bacteria were then supplemented with either AM-30C (drug) or placebo (P-30C). The drug-treated and placebo-treated bacteria were subjected to assay for DNA damage and oxidative stress 90 min after UV exposure. Several protocols like comet assay, gel electrophoresis for DNA ladder and intracellular reactive oxygen species (ROS) generation, and biomarker measurement like superoxide dismutase (SOD), catalase (CAT) and reduced glutathione (GSH) were conducted. The mRNA expressions of the excision repair genes like ultraviolet repair uvrA, B and C genes (or also known as excision repair genes) were estimated by reverse transcription-polymerase chain reaction method.
RESULTS: The UV-exposed bacteria showed DNA damage and oxidative stress, as revealed by an increase in ROS generation, and a decrease in SOD, CAT and GSH activities. As compared to placebo, the AM-30C-treated bacteria showed less DNA damage and oxidative stress as manifested by a decrease in ROS generation, and an increase in SOD, CAT and GSH activities. AM-30C also up-regulated the expression of repair genes as compared to the control.
CONCLUSION: AM-30C helped repair the DNA damage through up-regulation of repair genes and also ameliorated the oxidative stress through the reduction of ROS generation and suitable modulation of anti-oxidative stress enzymes.

Received November 6, 2011; accepted November 21, 2011; published online March 15, 2012.
Full-text LinkOut at PubMed. Journal title in PubMed: Zhong Xi Yi Jie He Xue Bao.

基金项目:This work was supported by a research grant from Boiron Laboratories, Lyon, France
Correspondence: Anisur Rahman Khuda-Bukhsh, PhD, Professor; Tel: +91-33-25828750-315; E-mail: prof_arkb@yahoo.co.in, khudabukhsh_48@rediffmail.com

  
      The increase in ultraviolet (UV) radiation on the surface of the earth due to depletion of the stratospheric ozone layer has recently fuelled a renewed interest in studies related to ascertaining various deleterious effects of UV-radiation on living organisms[1] and possible remedial measures. Radiation is one of the most effective and carcinogenic exogenous agents, that can interact directly with DNA or indirectly through generation of free radicals or reactive oxygen species (ROS), thus inducing DNA damage or altering the genomic integrity[2-5]. This can drastically affect normal life processes of all organisms ranging from lower prokaryotes to higher eukaryotes[6,7]. Therefore, most living organisms have developed an intrinsic mechanism to repair damaged DNA as early as possible.
     DNA damage caused by UV exposure is repaired mainly by direct reversal of DNA damage, particularly in the case of formation of cyclobutane pyrimidine dimers, by processes such as photoreactivation, by excision repair when there is a mismatch in complementary bases, and by post-replication repair[6,8-10]. However, cells have developed a number of repair or tolerance mechanisms to counteract various forms of DNA damage. The biochemical and molecular repair pathways have been extensively investigated in some model organisms such as Escherichia coli, Saccharomyces cerevisiae, and humans[11], where specialized repair proteins scan the genome continuously and encounter the DNA lesions by triggering several distinct intrinsic repair mechanisms, such as photo reactivation, nucleotide excision repair (NER)[12,13] and some other specialized repair systems such as SOS response which is an error-prone repair mechanism that comes into action when the amount of UV-irradiated DNA damage exceeds the capacity of the faithful repair system (NER) to correct that damage. This process can allow cell survival but often at the cost of mutagenesis.
     Since the NER pathway in E.coli has been extensively studied and is recognised as one of the major repair pathways to come into action in the case of DNA damage due to UV or ionizing radiations[11,14], the authors chose to examine whether the potentized remedy diluted beyond Avogadro’s limit (10-60 in the present study) could have any role or influence on the activities or expression levels of these repair genes in E. coli that regulate synthesis of the UvrA, B, C endonuclease enzyme complex consisting of the UvrA, B, C protein, and DNA helicase Ⅱ (sometimes also known as UvrD in this complex). In E. coli, NER is catalyzed by the products of mainly three genes (uvrA, B and C). The protein UvrA recognizes the damaged DNA and recruits UvrB and UvrC to the site of the lesion. UvrB and UvrC then cleave on the 3′ and 5′ sides of the damaged site, respectively, thus excising an oligonucleotide consisting of 12 or 13 bases. The action of helicase is then required to remove the damage-containing oligonucleotide from the double-stranded DNA molecule, and the resulting gap is filled by DNA polymerase Ⅰ and sealed by ligase[8].
     The selection of the potentized remedy Arnica Montana 30C (AM-30C) was based on claims made in homeopathy literature asserting the use of this remedy in effectively combating internal shock and injury[15]. Earlier studies have demonstrated that ultra-low doses of homeopathic remedies such as Ginseng 30C showed positive modulations of cytogenetical and haematological effects in whole body X ray-irradiated mice[16]. Similarly, potentized Arnica Montana, known for its wound-healing and anti-shock response properties, has been reported to have profound anticlastogenic actions in mice[17,18]. AM-30C has also been reported to ameliorate genotoxic effects of ultrasonic sound waves in mice[19].
     In recent years, there has been a renewed interest by large sectors of society in alternative forms of medicines due to the toxic nature and unwanted side effects of many orthodox medicines. Homeopathy, that often uses micro-doses of very high dilutions of natural substances originating from plants, minerals or animal parts[20,21], is one such alternative mode of treatment that is gaining popularity in many countries because of its none or negligible side effects although its efficacy is challenged by others. The initial drug substance is generally dissolved in aquatic ethanol (mostly 70%), known as the “mother tincture”. In the centesimal scale, when 1 mL of the mother tincture is diluted with 99 mL of aquatic ethanol (solvent vehicle of the drug) and given 10 jerks or succussions, potency 1C is produced. Further, when 1 mL of the potency 1C is again diluted with 99 mL of aquatic ethanol and given 10 jerks, the potency 2C is produced, and so on. Therefore, when the drug attains potency 12C, it becomes diluted to 10-24 (beyond Avogadro’s limit) and the existence of even a single molecule of the original drug substance in such high dilution becomes highly improbable. Although some researchers demonstrated the existence of nanoparticles of the original drug substance in such ultra-highly diluted homeopathic drugs[22], the efficacy is often questioned by rationalists, as the precise mechanism of drug action is still scientifically unknown. Therefore, the authors of this study assert that in-depth research is warranted to validate the efficacy of ultra-high dilutions in simple living forms and attempt to understand the molecular mechanism of its action.
     Thus, in the present investigation, the authors aimed to test the hypothesis that the potentized remedy, AM-30C, used against shock and injury, could show its efficacy in reducing DNA damage caused by UV irradiation in E. coli, and if successful, to understand the possible molecular mechanism involved to accomplish it.
 
  

1  Materials and methods
1.1  Culture and growth conditions of
E. coli  E. coli (E. coli-, F- wild type molecular biology strain) were obtained from the Department of Biochemistry and Biophysics, University of Kalyani, India, and maintained as a primary culture in the standard Luria-Bertani (LB, 0.5% yeast extract, 1% tryptone, 1% sodium chloride and 2% bacto agar) plates and slants. All experiments were performed with starved synchronized cells by following the protocol used by Saha et al[23]. Briefly, cells were first grown at 37 ℃ up to the log phase about 108 cells/mL (optical density at 600 nm for 108 cells/mL was found to be 0.2 by Shimadzu PharmaSpec UV-1700 spectrophotometer) in LB medium. The grown cells were washed with and suspended in a starvation buffer (5.0 g of potassium chloride (KCl), 1.0 g of sodium chloride (NaCl), 1.2 g of Tris, 0.1 g of magnesium sulphate (MgSO4), 1.0 mL of 1.0 mol/L calcium chloride (CaCl2) in 1 000 mL distilled water; pH adjusted to 8.1) and then were allowed to starve with shaking at 37 ℃ for 1 h for synchronization of cells.
1.2  UV irradiation  For UV exposure, cell suspension (in a starvation buffer) at a concentration of about 108 cells/mL was taken as a thin layer in a petri-dish (5 cm diameter), which was placed on ice in a tray and was shaken gently during irradiation. The UV lamp used to irradiate was of a strength 1.1 J/(m2·s). The cells were irradiated with several UV doses of 10, 25, 50, 75 and 100 J/m2 for 9, 22.5, 45, 67.5 and 90 s, respectively, according to the UV strength. The repair experiments were performed under dark conditions to avoid the possibility of photo reactivation-mediated repair of the UV-damaged E. coli cells.
1.3  Selection of sublethal dose and final treatment groups  From this UV-irradiated culture, 2% of cells each, were inoculated into a fresh LB media, which were subdivided into the following groups: UV-unirradiated LB control, LB plus UV dose-treated, LB plus UV dose plus drug AM-30C-treated, LB plus UV dose plus placebo-treated. From the dose response curve, two sublethal UV doses: dose 1 (25 J/m2) and dose 2 (50 J/m2) with cell survival percentages of approximately 60% and 26.5%, respectively, were finally selected and further experiments were proceeded with these two doses.
1.4  Replication  Different parameters of study mentioned below have been conducted on three subsets of experiments each and for each subset of experiment, three replicates were studied (n=9). For normalization of the data against a standard growth pattern of the bacteria, the mean values were produced.
1.5  Estimation of intracellular ROS generation  The intracellular ROS generation of the experimental cells was also analyzed qualitatively by a flow cytometer (BD FACS-ARIA)[24]. Cells grew up to their log phase and the accumulated ROS was measured by flow-cytometer using the 2′,7′-dichlorodihydrofluorescein diacetate (DCF-DA) dye after the UV doses 1 and 2 treatment and thereafter, addition of AM-30C and placebo-30C (P-30C), respectively. Cells were washed with phosphate buffer saline (PBS) and then incubated for 30 min with 40 nmol/L DCF-DA in dark conditions. Fluorescence was collected in the green channel fluorescent filter 1 (525 nm) of the flow cytometer equipped with an argon laser (488 nm) and with standard filter set up.
1.6  Superoxide dismutase and catalase assay  Specific activities of superoxide dismutase (SOD)[25] and catalase[26] in E. coli of different sets were quantified by spectrophotometric study.
1.7  Estimation of glutathione content  For glutathione (GSH) assay[27], cell extract was added to a reaction mixture of sulfosalicylic acid, sodium phosphate buffer (pH 8.0) and double distilled water. 5,5′-dithiobis(2-nitrobenzoic acid) solution was added and the absorbance was read at 412 nm by the spectrophotometric method.
1.8  DNA gel electrophoresis  Chromosomal DNA molecules were extracted from different sets of control and treated cells using the phenol-chloroform-isoamyl alcohol method and then were electrophoresed on 1.5% agarose gel in a Tris-acetate-EDTA (TAE) buffer with 0.5 μg/mL ethidium bromide (EtBr) and visualized under a UV trans-illuminator and photographed.
1.9  Comet assay  For comet assay[28], cells growing up to their log phase were suspended in 0.75% low melting agarose (containing 1 mg/mL lysozyme) and layered over a frosted microscopic slide. The slides immersed in a lysis buffer (pH 10.0) were followed by electrophoresis in a electrophoresis buffer (pH 13.0) for 20 min. After being washed with a neutralizing buffer (pH 7.5), those slides were stained with ethidium bromide (1 mg/mL) and examined under a fluorescence microscope (Leica DMLS, USA). The extent of DNA breakage was determined by measuring the comet tail length using the Motic Image Plus 2.0ML software, China.
1.10  RNA isolation, cDNA preparation and gene level expression study by reverse transcription-polymerase chain reaction  Total RNA was isolated from E. coli cells using TRIzol reagent (Bangalore Genei, Inida)[29]. To prepare cDNA, 2 μg of total RNA were reverse transcribed using oligo-dT primer in a final concentration of 100 mmol/L magnesium chloride (MgCl2), 750 mmol/L KCl and 500 mmol/L Tris (hydroxymethyl) aminomethane (Tris-HCl) (pH 8.3), 10 mmol/L of each deoxy nucleotide triphosphate (dNTPs), 20 units of RNase inhibitor and 10 units of Moloney murine leukaemia virus (M-MuLV) reverse transcriptase (RT) (Chromous Biotech, India).The mixture was incubated at 37 ℃ for 1 h and terminated at 95 ℃ for 2 min. Polymerase chain reaction (PCR) was performed using Taq DNA polymerase (Chromous Biotech, India) in accordance with the manufacturer’s instruction. Briefly 5 μL of reverse transcribed product (cDNA) were used in a total volume of 25 μL[26]. The primer sequences of the amplified genes are shown in Table 1. PCR was performed on an automated thermal cycler (Applied Biosystems, USA). For each PCR, pre-denaturation (95 ℃ for 3 min) was necessary before the amplification cycle (35 cycles) and after reaction there was a final extension phase at 72 ℃ for 10 min. Amplified cDNA products were separated on 1.0% agarose gel electrophoresis in a TAE buffer with 0.5 μg/mL ethidium bromide and visualized under the UV trans-illuminator and photographed. Densitometry was performed on a negative image using the ImageJ software. ImageJ software is a public domain software which was initially produced by Richard Stallman, at NIH, USA, and thereafter modified for various uses.

 

Table 1  The sequences of primers in reverse transcriptase-polymerase chain reaction

Primer name

Primer sequence (5′-3′)

uvrA

Forward: TAAGCTGCAAACGTTGATGG

Reverse: GTGCTCAATCACCACAATGG

uvrB

Forward: GTCTGGGCGATCCTGATTTA

Reverse: CAATCGTTCCACTTCCTCGT

uvrC

Forward: TCCGGGATCTTACTGTCGTC

Reverse: TGGAGTGCTTTGACATCAGC

G-3-PDH

Forward: CCCACTAACATCAAATGGGG

Reverse: CCTTCCACAATGCAAAGTT

G-3-PDH: glyceraldehyde-3-phosphate dehydrogenase.

1.11  Blinding  The observers were blinded during observation and scoring of the data. The different coded vials (containing randomized populations of E. coli) of both the experimental (containing drug AM-30C) and control sets along with placebo (P-30C; 70% succussed alcohol) were not known to the observers as to which one belonged to the treated or control group; they were only deciphered later to remove any bias in observation.
1.12  Statistical analysis  Data were presented as mean±standard error of mean. Statistical analysis was performed by Student’s paired t-test, one-way analysis of varience and post hoc analysis using SPSS 10.0 software. P<0.05 was considered significant.

  

2  Results
2.1  UV sublethal dose selection 
The UV dose-response curve is shown in Figure 1A. In this curve, initially the percentage of cell survival of E.coli decreased steadily which was followed by sharp decline in cell survival forming a gradual bending region (UV doses from 10 to 50 J/m2). That region of gradual bending is known as the shoulder region of the growth survival curve, whose corresponding dose is generally chosen as the sublethal dose where cells could repair most of the DNA lesion. Here the authors chose 25 and 50 J/m2 as dose 1 and dose 2, respectively, where the cell survival percentages were found to be 61% and 26.5%, respectively (Figures 1B and 1C).

Figure 1  E.coli dose-response curve under different UV irradiation doses

A: The dose-response curve; Bar graph showing the percentage of viable cells subjected to dose 1 (UV at 25 J/m2) and dose 2 (UV at 50 J/m2) are presented in B and C, respectively. Values were measured in three independent experiments done in triplicate. Mean±standard error of mean was plotted. **P<0.01, vs control; P<0.05, vs dose 1 (25 J/m2); ▲P<0.05, vs dose 2 (50 J/m2). UV: ultraviolet; AM30C: Arnica Montana 30C; P30C: placebo-30C.

2.2  Intracellular ROS measurement by flow cytometric analysis  The intracellular ROS generation in the control and treated groups are summarized in Figure 2. Generation of ROS showed the minimum in the control groups. Much ROS was generated when cells were treated with UV doses 1 and 2 which depicted a significant increase in the generation of intracellular ROS after UV irradiation. Treatment with AM-30C decreased ROS generation with respect to the UV dose-treated groups alone as well as with UV dose plus placebo-treated groups.

Figure 2  Intracellular reactive oxygen species generation in control and treatment groups

A: Control; B: Dose 1-treated; C: Dose 1 plus Arnica Montana-30C-treated; D: Dose 1 plus placebo-30C-treated; E: Dose 2-treated; F: Dose 2 plus Arnica Montana-30C-treated; G: Dose 2 plus placebo-30C-treated.


2.3  Measurement of the specific activity of SOD  Results of the specific activities of SOD in the control and treatment groups are summarized in Figure 3. The specific activity of SOD in E. coli cells decreased after UV doses 1 and 2 treatments, in comparison with the control cells. Again, AM-30C-treated cells showed a significant increase in SOD specific activity. The addition of placebo did not make any significant difference in specific activity of SOD in E. coli in UV dose 2-treated cells but was found to have marginally increased in UV dose 1-treated cells.



 

Figure 3  Data of superoxide dismutase assay

A bar graph showing specific activity of superoxide dismutase (μmol/(L·mg·min)) was plotted. Values were measured in three independent experiments carried out in triplicate and were expressed as mean±standard error of mean. **P<0.01, vs control; △△P<0.01, vs dose 1 (UV at 25 J/m2); ▲▲P<0.01, vs dose 2 (UV at 50 J/m2). AM30C: Arnica Montana 30C; P30C: placebo-30C.


2.4  Measurement of the specific activity of catalase  The specific activities of catalase in the control and treatment groups are summarized in Figure 4. In the UV-irradiated dose 1 group, the specific activity of catalase in E. coli cells significantly decreased compared with the control group. Addition of AM-30C to both the UV doses 1- and 2-treated cells showed a significant increase in catalase activity as compared to only UV-exposed ones.

Figure 4  Data of catalase assay

A bar graph showing specific activity of catalase (μmol/(L·mg·min)) was plotted. Values were measured in three independent experiments carried out in triplicate and were expressed as mean±standard error of mean. **P<0.01, vs control; △△P<0.01, vs dose 1 (UV at 25 J/m2); ▲P<0.05, ▲▲P<0.01, vs dose 2 (UV at 50 J/m2). AM30C: Arnica Montana 30C; P30C: placebo-30C.

2.5  GSH content assay  The amounts of intracellular GSH (free GSH to react with salicylic acid and 5,5′-dithiobis (2-nitrobenzoic acid) and respond to absorbance at 412 nm) are presented in Figure 5. The concentration of the free GSH in E. coli cells significantly decreased after UV doses 1 and 2 treatments as compared to the control ones. Addition of AM-30C to the treatment groups showed a considerable increase in the intracellular concentration of free GSH as compared to the only UV-treated groups. The addition of placebo did not make any significant difference in intracellular GSH concentration from that of only UV-treated groups.

Figure 5  Data of glutathione assay

Intracellular glutathione concentration in E.coli cells (μmol/L per 108 cells) was plotted. Values were measured in three independent experiments carried out in triplicate and were expressed as mean±standard error of mean. **P<0.01, vs control; P<0.05 vs dose 1 (25 J/m2); ▲▲P<0.01, vs dose 2 (50 J/m2). AM30C: Arnica Montana 30C; P30C: placebo-30C.


2.6  DNA damage studied through gel electrophoresis  Figure 6 represents the data of genomic DNA determined through agarose gel electrophoresis of different control and treatment groups of E. coli. UV-treated groups showed a smeared damaged DNA (smear indicates extensive DNA fragmentation) with respect to UV-unirradiated control cells showing a clear single band, representing an intact DNA. AM-30C-treated groups also showed a clear single band, while the placebo-treated cells also showed DNA smearing like that of the only UV-treated E. coli.



Figure 6  DNA damage assay through gel electrophoresis

Images of DNA gel after electrophoresis containing DNA samples of different treatments. A: Dose 1-treated; B: Dose 2-treated. Ln1: Control; Ln2: Ultraviolet-treated; Ln3: Ultraviolet plus Arnica Montana-30C-treated; Ln4: Ultraviolet plus placebo-30C-treated.

2.7  Comet assay  The DNA damage by comet assay in different control and treatment groups is summarized in Figure 7. Comet tail length was found to be the minimum in control cells. This indicates that there was almost no DNA damage in UV-unirradiated cells (a greater comet tail length depicts greater DNA damage). The comet tail lengths significantly increased in doses 1- and 2-treated groups when compared to the control. Addition of AM-30C to UV-irradiated cells resulted in a considerable decrease in comet tail lengths at both of the doses. The placebo-treated groups also showed a considerable increase in comet tail length like that of the UV-treated groups. Thus the values indicate that the drug reduced the quantum of DNA damage induced by UV radiation.

Figure 7  DNA damage analysis by comet assay

A: Photographs showing the DNA damage by comet assay.
B: Graphical representation of mean values of comet tail lengths (μm). Values were measured in three independent experiments carried out in triplicate and were expressed as mean ± standard error of mean. **P<0.01, vs control; P<0.05, vs dose 1 (25 J/m2); ▲▲P<0.01, vs dose 2 (50 J/m2).
(a) represents the ultraviolet-irradiated control cells, (b) and (e) represent ultraviolet doses 1- and 2-treated cells, respectively; (c) and (f) represent dose 1 plus Arnica Montana-30C-treated cells and dose 2 plus Arnica Montana-30C-treated cells, respectively; (d) and (g) represent dose 1 plus placebo-30C-treated cells and dose 2 plus placebo-30C-treated cells, respectively.


2.8  Gene expression analysis by RT-PCR  The mRNA expression levels of uvrA (GenBank accession number ECK4050), uvrB (GenBank accession number ECK0768) and uvrC (GenBank accession number ECK1912) genes and house-keeping gene (glyceraldehyde-3-phosphate dehydrogenase, GenBank accession number U82259) of E. coli cells in different control and treatment groups are summarized in Figure 8.

Figure 8  Gene expression analysis by RT-PCR

Arbitrary band intensities of uvrA, B and C were analyzed against the house keeping gene G-3-PDH under different conditions. Ln1: Control; Ln2: Dose 1-treated; Ln3: Dose 1 plus Arnica Montana-30C-treated; Ln4: Dose 1 plus placebo-30C-treated; Ln5: Dose 2-treated; Ln6: Dose 2 plus Arnica Montana-30C-treated; Ln7: Dose 2 plus placebo-30C-treated. G-3-PDH: glyceraldehyde-3-phosphate dehydrogenase; RT-PCR: reverse transcription-polymerase chain reaction.


     The arbitrary band intensity level of uvrA, B and C genes showed increased expression levels both in UV doses 1- and 2-treated cells when compared to UV-unirradiated control cells, whereas, in the case of AM-30C-treated groups, the arbitrary band intensity resulted in a significant increase in both of the dose levels. Addition of placebo did not make that much significant difference in band intensity from that of only UV dose-treated groups except for dose 2 plus placebo-treated group which revealed significant over-expression of uvrA only. The intensity of the band was known to be expression-dependent, namely, a more intense band indicates more genetic level expression.

  

3  Discussion
    
Results of the present study revealed DNA damage and generation of oxidative stress in E. coli as a result of exposure to UV radiation, more in quantity at the longer and higher exposures. UV irradiation-included generation of oxidative stress was revealed by different assay protocols. Furthermore, after exposure to UV radiation, the expressions of uvrA, B and C genes responsible for repair of DNA damage showed an up-regulation, as compared to the control.
     UV radiation induces damage through the generation of free radicals or ROS[4,5]. The highly toxic superoxide anion (O2-) seriously disrupts normal metabolism through oxidative damage to cellular components. Oxygen-free radicals can also be converted to reactive hydroxyl radicals, which again can cause DNA damage. Intracellular ROS attack both the bases and the sugar moieties, producing single and double-strand breaks in the backbone, adducts of base, sugar groups and cross-links to other molecules that block replication[30,31]. Therefore, elimination of superoxide anion is definitely necessary for the survival of cells[32]. Results of the present study showed that AM-30C significantly reduced intracellular ROS generation. This was supported by an increase in activities of some biomarkers like SOD, catalase and free intracellular GSH content which decreased after UV exposure. SOD as part of the defence system against oxidative damage in aerobic organisms[33-35] catalyzes superoxide anion (O2-) to oxygen (O2) and hydrogen peroxide (H2O2), which then gets reduced to water (H2O) by H2O2-scavenging enzyme catalase[36]. Therefore, SOD and catalase are the weapons to restrict the accumulation of ROS. In these findings, both SOD and catalase showed a marked increase in their specific activities on AM-30C treatment. Some molecules such as ascorbic acid and GSH are constitutively present and help maintain an intracellular reducing environment or scavenge reactive oxygen and protect themselves from the attack of ROS.
     In the UV-exposed E. coli administered AM-30C, there was less DNA damage as determined from the analysis of data through comet assay and DNA gel electrophoresis. Therefore, it is evident that AM-30C has an ameliorative effect on UV-exposed E. coli, which is not an “ethanol effect” as the placebo-treated E. coli did not show such ameliorative responses. As DNA repair in E. coli is known to be accomplished through the activities of the specific repair genes, this study focuses on the expression levels of these genes. Interestingly, there was clear evidence of the over-expression of these genes, depicting an up-regulation and enhanced activities of these repair genes. Since the over-expression of these genes being absent in the E. coli treated with the placebo (except for uvrA expression in dose 2 plus placebo-treated group), it could be logically concluded that AM-30C must have played a role in the alteration of the expression level of these repair genes. To ascertain if the up-regulation of these genes by AM-30C could be further confirmed, the authors performed RT-PCR on mRNA of uvrA, B and C genes, and again, the results were confirmatory of the over-expression of the mRNA of these specific proteins. Therefore, the results of the present investigation actually vindicated the hypothesis advocated by Khuda-Bukhsh and his collaborators since long that one major way by which the potentized homeopathic drug would act is by the regulation of expression of the relevant genes. Khuda-Bukhsh et al[17,20,21,37-39] also found much evidence of alteration in gene expression in a mammalian model (Mus musculus) after administration of potentized homeopathic drugs and demonstrated change in many signal proteins in cancerous mice[40]. Other researchers are encouraged to verify these results and design experiments of a similar kind to reveal further steps of gene regulatory mechanisms involved.

  

4  Acknowledgements
    
This work was financially supported by a grant sanctioned to Prof. A.R. Khuda-Bukhsh, Department of Zoology, University of Kalyani, India by Boiron Laboratory, Lyon, France. We are also thankful to Dr. Tarakdas Basu and Dr. Swati Saha, Department of Biochemistry, Mr. Arghya Bandyopadhyay, Department of Microbiology, University of Kalyani, India, Dr. Mamata Chawla Sarkar and Mr. Parikshit Bagchi, Department of Virology, National Institute of Cholera and Enteric Diseases, India and Dr. Samir Kumar Mukherjee, Department of Microbiology, University of Kalyani, India, for permitting us to use their laboratory for conducting a part of the work.

  

5  Competing interests
    
The authors declare that they have no competing interests.

  
References
1. Lubin D, Jensen EH. Effects of clouds and stratospheric ozone depletion on ultraviolet radiation trends[J]. Nature, 1995, 377(6551) : 710-713.
[CAT]    
2. Taylor JS. DNA, sunlight, and skin cancer[J]. Pure Appl Chem, 1990, 67(1) : 183-190.
[ICN2]    
3. Wiseman H, Halliwell B. Damage to DNA by reactive oxygen and nitrogen species: role in inflammatory disease and progression to cancer[J]. Biochem J, 1996, 313(Pt 1) : 17-29.
  
4. Valko M, Rhodes CJ, Moncol J, Izakovic M, Mazur M. Free radicals, metals and antioxidants in oxidative stress-induced cancer[J]. Chem Biol Interact, 2006, 160(1) : 1-40.
    
5. Halliwell B, Gutteridge J. Free radicals in biology and medicine. 4th ed. Oxford: Oxford University Press. 2007.
6. Sinha RP, Hder DP. UV-induced DNA damage and repair: a review[J]. Photochem Photobiol Sci, 2002, 1(4) : 225-236.
    
7. Solomon KR. Effects of ozone depletion and UV-B radiation on humans and the environment[J]. Atmos Ocean, 2008, 46(1) : 185-202.
  [Tandfonline]  
8. Cooper GM. The cell: a molecular approach. Washington: Sinauer Associates Inc. 1997.
9. Ravanat JL, Douki T, Cadet J. Direct and indirect effects of UV radiation on DNA and its components[J]. J Photochem Photobiol B, 2001, 63(1-3) : 88-102.
    
10. de Lima-Bessa KM, Armelini MG, Chiganas V, Jacysyn JF, Amarante-Mendes GP, Sarasin A, Menck CF. CPDs and 6-4PPs play different roles in UV-induced cell death in normal and NER-deficient human cells[J]. DNA Repair (Amst), 2008, 7(2) : 303-312.
    
11. E. coli K-12[J]. Proc Natl Acad Sci U S A, 1964, 51: 293-300.
  
12. Lin JJ, Sancar A. Reconstitution of nucleotide excision nuclease with UvrA and UvrB proteins from Escherichia coli and UvrC protein from Bacillus subtilis. J Biol Chem. 1990; 265(34): 21337-21341.
  
13. Escherichia coli. Disassembly of the UvrBC-DNA complex by helicase Ⅱ and DNA polymerise Ⅰ[J]. J Biol Chem, 1992, 267(2) : 780-788.
  
14. Pettijohn DE, Hanawalt P. Evidence for repair replication of ultraviolet damaged DNA in bacteria[J]. J Mol Biol, 1964, 9: 395-410.
    
15. Boericke W. Pocket manual of homeopathic materia medica. Calcutta: Sett Dey and Co. 1976.
16. Mitra K, Kundu SN, Khuda-Bukhsh AR. Efficacy of a potentized homoeopathic drug (Arsenicum Album-30) in reducing toxic effects produced by arsenic trioxide in mice: Ⅰ. On rate of accumulation of arsenic in certain vital organs[J]. Complement Ther Med, 1998, 6(4) : 178-184.
  [Sciencedirect]  
17. Khuda-Bukhsh AR. Potentized homoeopathic drugs act through regulation of gene-expression: a hypothesis to explain their mechanism and pathways of action in vitro[J]. Complement Ther Med, 1997, 5(1) : 43-46.
  [Sciencedirect]  
18. Biswas SJ, Khuda-Bukhsh AR. Effect of a homeopathic drug, Chelidonium, in amelioration of p-DAB induced hepatocarcinogenesis in mice[J]. BMC Complement Altern Med, 2002, 2: 4.
    
19. Chakrabarti J, Biswas SJ, Khuda-Bukhsh AR. Cytogenetical effects of sonication in mice and their modulations by actinomycin D and a homeopathic drug, Arnica 30[J]. Indian J Exp Biol, 2001, 39(12) : 1233-1242.
  
20. Khuda-Bukhsh AR. Laboratory research in homeopathy: pro[J]. Intregr Cancer Ther, 2006, 5(4) : 320-332.
    
21. Khuda-Bukhsh AR, Pathak S. Homeopathic drug discovery: theory update and methodological aspect[J]. Expert Opin Drug Discov, 2008, 3(8) : 979-990.
[informahealthcare]    
22. Chikramane PS, Suresh AK, Bellare JR, Kane SG. Extreme homeopathic dilutions retain starting materials: A nanoparticulate perspective[J]. Homeopathy, 2010, 99(4) : 231-242.
    
23. Saha S, Jana B, Basu T. The two inducible responses, SOS and heat-shock, in Escherichia coli act synergistically during Weigle reactivation of the bacteriophage phiX174. Int J Radiat Biol. 2007; 83(7): 463-469.
    
24. Kakkar P, Das B, Viswanathan PN. A modified spectrophotometric assay of superoxide dismutase[J]. Indian J Biochem Biophys, 1984, 21(2) : 130-132.
  
25. Omran RG. Peroxide levels and the activities of catalase, peroxidase, and indoleacetic acid oxidase during and after chilling cucumber seedlings[J]. Plant Physiol, 1980, 65(2) : 407-408.
    
26. Sedlak J, Lindsay RH. Estimation of total, protein-bound, and nonprotein sulfhydryl groups in tissue with Ellman’s reagent[J]. Anal Biochem, 1968, 25(1) : 192-205.
    
27. Dhawan A, Mathur N, Seth PK. The effect of smoking and eating habits on DNA damage in Indian population as measured in the Comet assay[J]. Mutat Res, 2001, 474(1-2) : 121-128.
    
28. Chowdhury R, Dutta A, Chaudhuri SR, Sharma N, Giri AK, Chaudhuri K. In vitro and in vivo reduction of sodium arsenite induced toxicity by aqueous garlic extract[J]. Food Chem Toxicol, 2008, 46(2) : 740-751.
    
29. Dhiman R, Kathania M, Raje M, Majumdar S. Inhibition of bfl-1/A1 by siRNA inhibits mycobacterial growth in THP-1 cells by enhancing phagosomal acidification[J]. Biochim Biophys Acta, 2008, 1780(4) : 733-742.
    
30. Sies H, Menck CF. Singlet oxygen induced DNA damage[J]. Mutat Res, 1992, 275(3-6) : 367-375.
  
31. Sies H. Damage to plasmid DNA by singlet oxygen and its protection[J]. Mutat Res, 1993, 299(3-4) : 183-191.
    
32. Yao XH, Min H, Lv ZM. Response of superoxide dismutase, catalase, and ATPase activity in bacteria exposed to acetamiprid[J]. Biomed Environ Sci, 2006, 19(4) : 309-314.
  
33. Imlay JA, Chin SM, Linn S. Toxic DNA damage by hydrogen peroxide through the Fenton reaction in vivo and in vitro[J]. Science, 1988, 240(4852) : 640-642.
    
34. Chen JR, Weng CN, Ho TY, Cheng IC, Lai SS. Identification of the copper-zinc superoxide dismutase activity in Mycoplasma hyopneumoniae[J]. Vet Microbiol, 2000, 73(4) : 301-310.
    
35. Gerlach D, Reichardt W, Vettermann S. Extracellular superoxide dismutase from Streptococcus pyogenes type 12 strain is manganese-dependent[J]. FEMS Microbiol Lett, 1998, 160(2) : 217-224.
    
36. Jung S. Expression level of specific isozymes of maize catalase mutants influences other antioxidants on norflurazon-induced oxidative stress[J]. Pestic Biochem Physiol, 2003, 75(1-2) : 9-17.
  [Sciencedirect]  
37. Khuda-Bukhsh AR. Towards understanding molecular mechanisms of action of homeopathic drugs: an overview[J]. Mol Cell Biochem, 2003, 253(1-2) : 339-345.
    
38. Khuda-Bukhsh AR. Mice as a model for homeopathy research[J]. Homeopathy, 2009, 98(4) : 267-279.
    
39. Mallick P, Mallick JC, Guha B, Khuda-Bukhsh AR. Ameliorating effect of microdoses of a potentized homeopathic drug, Arsenicum Album, on arsenic-induced toxicity in mice[J]. BMC Complement Altern Med, 2003, 3: 7.
    
40. Bhattacharyya SS, Mandal SK, Biswas R, Paul S, Pathak S, Boujedaini N, Belon P, Khuda-Bukhsh AR. In vitro studies demonstrate anticancer activity of an alkaloid of the plant Gelsemium sempervirens[J]. Exp Biol Med (Maywood), 2008, 233(12) : 1591-1601.
    
  
This article has been cited by other articles ( Within JCIM & JIM )
1. Ultra-highly diluted plant extracts of Hydrastis canadensis and Marsdenia condurango induce epigenetic modifications and alter gene expression profiles in HeLa cells in vitro. 2015, 13(6)

Reader's comments
1. christian louboutin wedding shoes christian louboutin shoes canada http://canadachristianlouboutin.blogspot.com/ (2016-1-20 0:00:00)
2. louboutin men christian louboutin http://canadachristianlouboutinoutlet.blogspot.com/ (2016-1-25 0:00:00)
3. christian louboutins christian louboutin online outlet http://canadachristianlouboutinoutlet.blogspot.com/ (2016-1-25 0:00:00)
4. cheap christian louboutin canada christian louboutin online http://canadachristianlouboutinoutlet.blogspot.com/ (2016-2-22 0:00:00)
5. christian louboutin shoes canada christian louboutin shoes sale http://canadachristianlouboutinoutlet.blogspot.com/ (2016-2-23 0:00:00)
6. red sole shoes christian louboutin cheapest http://canadachristianlouboutin.blogspot.com/ (2016-2-24 0:00:00)
7. Beloved, some sort of native of your Chicago suburb connected with Lemont, was basically solid in his first of all postseason start just after Corey Crawford appeared to be ineffective inside first of all two video games from the series. The exact rookie additionally changed Crawford throughout Game 1 then made 45 stops given that the Blackhawks came back to get a 4-3 landslide ? defeat ? upset ? result in increase overtime. nike free 4.0 flyknit http://runningshoes-shop.com/24-nike-free-40 (2016-10-8 0:00:00)
8. The main Blackhawks, who entered the particular Water wells Fargo Middle here off of any 3-1 victory Monday afternoon within Carolina, missed a older opportunity from the showing Flyers, who received displaced four consecutive games along with whose playoff hope were candle lit because suffering a good heartbreaking overtime loss on the Boston ma Bruins on March several. rangers jerseys http://rangers-jerseys.us/33-mens (2016-10-9 0:00:00)
9. System #2 cheap cubs jerseys http://www.cubs-jerseys.us/6-mens (2016-10-9 0:00:00)
10. UhHaPe http://www.FyLitCl7Pf7kjQdDUOLQOuaxTXbj5iNG.com (2016-10-14 0:00:00)
11. D7433J http://www.FyLitCl7Pf7kjQdDUOLQOuaxTXbj5iNG.com (2016-10-15 0:00:00)
12. D7433J http://www.FyLitCl7Pf7kjQdDUOLQOuaxTXbj5iNG.com (2016-10-15 0:00:00)
13. 4Ge7y0 http://www.FyLitCl7Pf7kjQdDUOLQOuaxTXbj5iNG.com (2016-10-15 0:00:00)
14. 4Ge7y0 http://www.FyLitCl7Pf7kjQdDUOLQOuaxTXbj5iNG.com (2016-10-15 0:00:00)
15. Hence enthusiasticallyI commenced including a small amount of time later on decided I needed to supply personally some sort of serverslap inside the point!! The concepts I actually pondering? there have been so many things I did not take into consideration so when I actually finally received my first of all lure within the mineral water I practically stopped working and also wept. Thething may not frolic in the water properly plus the paintwas approaching off right after not very many casts. At that point I was ready to toss it with and assumed you wrote a wast your own time yet after giving it a tad bit more notion, (which I have to did within the very first place), Choice to take a moment and make " up " plans of which took note principle problems that Ihad not necessarily taken into consideration together with problems I had developed certainly not idea of!! Marcus Kruger Jersey http://www.blackhawks-jerseys.us/58-marcus-kruger-jersey (2016-10-18 0:00:00)
16. Next, drive your other foot holding your hips low and curved, since synchronize in your your feet throw the hands way up hard towards questionable bettor. You now are well grown at the front and unfortunately your scalp has to be for direct email. Under no circumstances, ever before, ever previously tackle using the very best within your person along, thanks and square from your foe. Very best way to insure you happen to be within the correct position would be to train touching your individual facemask into the football on the the other guitar player. patrice bergeron jersey http://bruins-jerseys.com/32-patrice-bergeron-jersey (2016-10-20 0:00:00)
17. Precisely why? For the reason that traditionally, cost was agreed upon before your period, dependant on possibilities and chances (not unlike the aforementioned singers and sporting stars). In the foreseeable future, nonetheless , have to shift more close to your merit-based "pay to get performance" model which may on hossa jersey http://www.blackhawksfanjerseys.com/51-marian-hossa-jersey (2016-10-24 0:00:00)
18. Wheeled walking frames blackhawks winter classic jersey 2017 http://www.blackhawks-jerseys.us/ (2016-10-24 0:00:00)
19. The guy later on joked how the game enthusiasts were all of endeavoring to become their own teammate, the ultra-lean Tim Davidson. canada hockey jersey https://wcohockey2016.wordpress.com/ (2016-10-25 0:00:00)
20. This unique conference would be gone to by sales and marketing specialists from Large amounts of money 500 firms and various other productive establishments. black blackhawks jersey https://blackhawks2017.wordpress.com/ (2016-10-26 0:00:00)
21. It can also be simple to put aside, it seems that, that Sidney Crosby is certainly real human. air max 1 http://runningshoes-shop.com/18-nike-air-max-1 (2016-10-28 0:00:00)
22. 2) Competitors who sadly are very great at toting typically the puck on the pungent zone and maintaining control are exceedingly important, and in turn this simply means they are really significantly aiding for driving ownership while they're to the ice. Nick Schmaltz Jersey http://bruinsblooog.blogspot.com/ (2016-10-28 0:00:00)
23. Going and going for walks put very good stress within the joint parts, so much so the kneecap can alter from location. As opposed to upgrading plus downward, it might learn to approach sideways, and ultimately wear out the very cartilage. When preparing, solution can build interior vicinity, which results in ache and bloating. Regarding immediate medication, relaxation is better answer. However , long-term management involves muscle exercise, checked stretch, in addition to physical therapy. The way in which Sports Mindsets Can Strengthen General performance nike shoes for men http://www.airmaxshoes-2016.com (2016-11-6 0:00:00)
24. As being the expressing comes, ??Haters likely to hate??. Nobleman fans know a party which includes repeatedly demonstrated judgments is nothing, outside the house noise is definitely probability to surge and exactly will not kill people helps you with how to cope with15462 any kind of situation. nike air max 90 http://www.airmaxshoes-2016.com/39-nike-air-max-90 (2016-11-7 0:00:00)
25. What's up,I check your blogs named "Journal of Chinese Integrative Medicine Free Full Text" regularly.Your humoristic style is awesome, keep up the good work! And you can look our website about love spell https://0lovespells0.blogspot.com/. (2017-6-16 0:00:00)

Send a comment

 Home | Current Issue | Past Issues | SearchRSS
Copyright © 2013-2018 by JIM Editorial Office. All rights reserved. ISSN 2095-4964; CN 31-2083/R. 沪ICP备110264号