SUBSCRIBE
Search JIM Advanced Search

Journal of Chinese Integrative Medicine ›› 2012, Vol. 10 ›› Issue (3): 337-246.doi: 10.3736/jcim20120314

• Original Experimental Research • Previous Articles     Next Articles

Potential of the homeopathic remedy, Arnica Montana 30C, to reduce DNA damage in Escherichia coli exposed to ultraviolet irradiation through up-regulation of nucleotide excision repair genes

Das Sreemanti,Kumar Saha Santu,De Arnab,Das Durba,Rahman Khuda-Bukhsh Anisur()   

  1. Cytogenetics and Molecular Biology Laboratory, Department of Zoology, University of Kalyani, Kalyani 741235, IndiaCytogenetics and Molecular Biology Laboratory, Department of Zoology, University of Kalyani, Kalyani 741235, India
  • Received:2011-11-06 Accepted:2011-11-21 Online:2012-03-20 Published:2018-10-10

RichHTML

PDF (PC)

66

Like

OBJECTIVE: To examine to what degree an ultra-highly diluted homeopathic remedy, Arnica Montana 30C (AM-30C), used in the treatment of shock and injury, can modulate the expression of nucleotide excision repair genes in Escherichia coli exposed to ultraviolet (UV) irradiation.
METHODS: E. coli were cultured to their log phase in a standard Luria-Bertani medium and then exposed to sublethal doses of UV irradiation at 25 and 50 J/m 2 for 22.5 and 45 s, respectively. The UV-exposed bacteria were then supplemented with either AM-30C (drug) or placebo (P-30C). The drug-treated and placebo-treated bacteria were subjected to assay for DNA damage and oxidative stress 90 min after UV exposure. Several protocols like comet assay, gel electrophoresis for DNA ladder and intracellular reactive oxygen species (ROS) generation, and biomarker measurement like superoxide dismutase (SOD), catalase (CAT) and reduced glutathione (GSH) were conducted. The mRNA expressions of the excision repair genes like ultraviolet repair uvrA, B and C genes (or also known as excision repair genes) were estimated by reverse transcription-polymerase chain reaction method.
RESULTS: The UV-exposed bacteria showed DNA damage and oxidative stress, as revealed by an increase in ROS generation, and a decrease in SOD, CAT and GSH activities. As compared to placebo, the AM-30C-treated bacteria showed less DNA damage and oxidative stress as manifested by a decrease in ROS generation, and an increase in SOD, CAT and GSH activities. AM-30C also up-regulated the expression of repair genes as compared to the control.
CONCLUSION: AM-30C helped repair the DNA damage through up-regulation of repair genes and also ameliorated the oxidative stress through the reduction of ROS generation and suitable modulation of anti-oxidative stress enzymes.

Key words: Escherichia coli, ultraviolet rays, homeopathy, Arnica, reactive oxygen species, DNA damage, DNA repair

"

Primer name Primer sequence (5′-3′)
uvrA Forward: TAAGCTGCAAACGTTGATGG
Reverse: GTGCTCAATCACCACAATGG
uvrB Forward: GTCTGGGCGATCCTGATTTA
Reverse: CAATCGTTCCACTTCCTCGT
uvrC Forward: TCCGGGATCTTACTGTCGTC
Reverse: TGGAGTGCTTTGACATCAGC
G-3-PDH Forward: CCCACTAACATCAAATGGGG
Reverse: CCTTCCACAATGCAAAGTT

Figure 1

E.coli dose-response curve under different UV irradiation doses A: The dose-response curve; Bar graph showing the percentage of viable cells subjected to dose 1 (UV at 25 J/m2) and dose 2 (UV at 50 J/m2) are presented in B and C, respectively. Values were measured in three independent experiments done in triplicate. Mean±standard error of mean was plotted. **P<0.01, vs control; △P<0.05, vs dose 1 (25 J/m2); ▲P<0.05, vs dose 2 (50 J/m2). UV: ultraviolet; AM30C: Arnica Montana 30C; P30C: placebo-30C."

Figure 2

Intracellular reactive oxygen species generation in control and treatment groups A: Control; B: Dose 1-treated; C: Dose 1 plus Arnica Montana-30C-treated; D: Dose 1 plus placebo-30C-treated; E: Dose 2-treated; F: Dose 2 plus Arnica Montana-30C-treated; G: Dose 2 plus placebo-30C-treated."

Figure 3

Data of superoxide dismutase assay A bar graph showing specific activity of superoxide dismutase (μmol/(L·mg·min)) was plotted. Values were measured in three independent experiments carried out in triplicate and were expressed as mean±standard error of mean. **P<0.01, vs control; △△P<0.01, vs dose 1 (UV at 25 J/m2); ▲▲P<0.01, vs dose 2 (UV at 50 J/m2). AM30C: Arnica Montana 30C; P30C: placebo-30C."

Figure 4

Data of catalase assay A bar graph showing specific activity of catalase (μmol/(L·mg·min)) was plotted. Values were measured in three independent experiments carried out in triplicate and were expressed as mean±standard error of mean. **P<0.01, vs control; △△P<0.01, vs dose 1 (UV at 25 J/m2); ▲P<0.05, ▲▲P<0.01, vs dose 2 (UV at 50 J/m2). AM30C: Arnica Montana 30C; P30C: placebo-30C."

Figure 5

Data of glutathione assay Intracellular glutathione concentration in E.coli cells (μmol/L per 108 cells) was plotted. Values were measured in three independent experiments carried out in triplicate and were expressed as mean±standard error of mean. **P<0.01, vs control; △P<0.05 vs dose 1 (25 J/m2); ▲▲P<0.01, vs dose 2 (50 J/m2). AM30C: Arnica Montana 30C; P30C: placebo-30C."

Figure 6

DNA damage assay through gel electrophoresis Images of DNA gel after electrophoresis containing DNA samples of different treatments. A: Dose 1-treated; B: Dose 2-treated. Ln1: Control; Ln2: Ultraviolet-treated; Ln3: Ultraviolet plus Arnica Montana-30C-treated; Ln4: Ultraviolet plus placebo-30C-treated."

Figure 7

DNA damage analysis by comet assay A: Photographs showing the DNA damage by comet assay. B: Graphical representation of mean values of comet tail lengths (μm). Values were measured in three independent experiments carried out in triplicate and were expressed as mean ± standard error of mean. **P<0.01, vs control; △P<0.05, vs dose 1 (25 J/m2); ▲▲P<0.01, vs dose 2 (50 J/m2). (a) represents the ultraviolet-irradiated control cells, (b) and (e) represent ultraviolet doses 1- and 2-treated cells, respectively; (c) and (f) represent dose 1 plus Arnica Montana-30C-treated cells and dose 2 plus Arnica Montana-30C-treated cells, respectively; (d) and (g) represent dose 1 plus placebo-30C-treated cells and dose 2 plus placebo-30C-treated cells, respectively."

Figure 8

Gene expression analysis by RT-PCR Arbitrary band intensities of uvrA, B and C were analyzed against the house keeping gene G-3-PDH under different conditions. Ln1: Control; Ln2: Dose 1-treated; Ln3: Dose 1 plus Arnica Montana-30C-treated; Ln4: Dose 1 plus placebo-30C-treated; Ln5: Dose 2-treated; Ln6: Dose 2 plus Arnica Montana-30C-treated; Ln7: Dose 2 plus placebo-30C-treated. G-3-PDH: glyceraldehyde-3-phosphate dehydrogenase; RT-PCR: reverse transcription-polymerase chain reaction."

[1] Lubin D, Jensen EH . Effects of clouds and stratospheric ozone depletion on ultraviolet radiation trends. Nature. 1995; 377(6551) : 710-713.
doi: 10.1038/377710a0
[2] Taylor JS . DNA, sunlight, and skin cancer. Pure Appl Chem. 1990; 67(1):183-190.
[3] Wiseman H, Halliwell B . Damage to DNA by reactive oxygen and nitrogen species : role in inflammatory disease and progression to cancer. Biochem J. 1996; 313(Pt 1) : 17-29.
doi: 10.1042/bj3130017
[4] Valko M, Rhodes CJ, Moncol J, Izakovic M, Mazur M . Free radicals, metals and antioxidants in oxidative stress-induced cancer. Chem Biol Interact. 2006; 160(1):1-40.
doi: 10.1016/j.cbi.2005.12.009
[5] Halliwell B, Gutteridge J. Free radicals in biology and medicine. 4th ed. Oxford: Oxford University Press. 2007.
[6] Sinha RP, Häder DP . UV-induced DNA damage and repair : a review. Photochem Photobiol Sci. 2002 ; 1(4):225-236.
doi: 10.1039/b201230h
[7] Solomon KR . Effects of ozone depletion and UV-B radiation on humans and the environment. Atmos Ocean. 2008; 46(1) : 185-202.
doi: 10.3137/ao.460109
[8] Cooper GM . The cell: a molecular approach. Washington: Sinauer Associates Inc. 1997.
[9] Ravanat JL, Douki T, Cadet J . Direct and indirect effects of UV radiation on DNA and its components. J Photochem Photobiol B. 2001; 63(1-3):88-102.
doi: 10.1016/S1011-1344(01)00206-8
[10] de Lima-Bessa KM, Armelini MG, Chigangas V, Jacysyn JF, Amarante-Mendes GP, Sarasin A, Menck CF . CPDs and 6-4PPs play different roles in UV- induced cell death in normal and NER-deficient human cells. DNA Repair (Amst). 2008; 7(2):303-312.
doi: 10.1016/j.dnarep.2007.11.003
[11] Boyce RP, Howard-Flanders P . Release of ultraviolet light-induced thymine dimers from DNA in E. coli K- 12. Proc Natl Acad Sci USA. 1964; 51:293-300.
doi: 10.1073/pnas.51.2.293
[12] Lin JJ, Sancar A . Reconstitution of nucleotide excision nuclease with UvrA and UvrB proteins from Escherichia coli and UvrC protein from Bacillus subtilis. J Biol Chem. 1990; 265(34):21337-21341.
[13] Orren DK, Selby CP, Hearst JE, Sancar A . Post-incision steps of nucleotide excision repair in Escherichia coli. Disassembly of the UvrBC-DNA complex by helicase E and DNA polymerise I . J Biol Chem. 1992; 267(2):780-788.
[14] Pettijohn DE, Hanawalt P . Evidence for repair replication of ultraviolet damaged DNA in bacteria. J Mol Biol. 1964; 9:395-410.
doi: 10.1016/S0022-2836(64)80216-3
[15] Boericke W . Pocket manual of homeopathic materia medica. Calcutta: Sett Dey and Co . 1976.
[16] Mitra K, Kundu SN, Khuda-Bukhsh AR . Efficacy of a potentized homoeopathic drug (Arsenicum Album-30) in reducing toxic effects produced by arsenic trioxide in mice: I . On rate of accumulation of arsenic in certain vital organs. Complement Ther Med. 1998; 6(4) : 178-184.
[17] Khuda-Bukhsh AR . Potentized homoeopathic drugs act through regulation of gene-expression: a hypothesis to explain their mechanism and pathways of action in vitro . Complement Ther Med. 1997 ; 5(1) : 43-46.
doi: 10.1016/S0965-2299(97)80090-8
[18] Biswas SJ, Khuda-Bukhsh AR . Effect of a homeopathic drug, Chelidonium, in amelioration of p-DAB induced hepatocarcinogenesis in mice. BMC Complement Altern Med. 2002; 2:4.
doi: 10.1186/1472-6882-2-4
[19] Chakrabarti J, Biswas SJ, Khuda-Bukhsh AR . Cytogenetical effects of sonication in mice and their modulations by actinomycin D and a homeopathic drug, Arnica 30. Indian J Exp Biol. 2001; 39(12):1233-1242.
[20] Khuda-Bukhsh AR . Laboratory research in homeopathy: pro. Intregr Cancer Ther. 2006; 5(4) : 320-332.
doi: 10.1177/1534735406294794
[21] Khuda-Bukhsh AR, Pathak S . Homeopathic drug discovery: theory update and methodological aspect. Expert Opin Drug Discov. 2008; 3(8):979-990.
doi: 10.1517/17460441.3.8.979
[22] Chikramane PS, Suresh AK, Bellare JR, Kane SG . Extreme homeopathic dilutions retain starting materials : A nanoparticulate perspective. Homeopathy. 2010 ; 99(4):231-242.
doi: 10.1016/j.homp.2010.05.006
[23] Saha S, Jana B, Basu T . The two inducible responses, SOS and heat-shock, in Escherichia coli act synergisti- cally during Weigle reactivation of the bacteriophage phiX174. Int J Radiat Biol. 2007; 83(7):463-469.
doi: 10.1080/09553000701371389
[24] Kakkar P, Das B, Viswanathan PN . A modified spec- trophotometric assay of superoxide dismutase. Indian J Biochem Biophys. 1984; 21(2):130-132.
[25] Omran RG . Peroxide levels and the activities of catalase, peroxidase, and indoleacetic acid oxidase during and after chilling cucumber seedlings. Plant Physiol. 1980; 65(2) : 407-408.
doi: 10.1104/pp.65.2.407
[26] Sedlak J, Lindsay RH . Estimation of total, protein- bound, and nonprotein sulfhydryl groups in tissue with Ellman ’ s reagent. Anal Biochem. 1968; 25(1):192-205.
doi: 10.1016/0003-2697(68)90092-4
[27] Dhawan A, Mathur N, Seth PK . The effect of smoking and eating habits on DNA damage in Indian population as measured in the Comet assay. Mutat Res. 2001 ; 474(1-2) : 121-128.
doi: 10.1016/S0027-5107(00)00171-8
[28] Chowdhury R, Dutta A, Chaudhuri SR, Sharma N, Giri AK, Chaudhuri K . In vitro and in vivo reduction of sodium arsenite induced toxicity by aqueous garlic extract. Food Chem Toxicol. 2008; 46(2):740-751.
doi: 10.1016/j.fct.2007.09.108
[29] Dhiman R, Kathania M, Raje M, Majumdar S . Inhibition of bfl-l/Al by siRNA inhibits mycobacterial growth in THP-1 cells by enhancing phagosomal acidification. Biochim Biophys Acta. 2008; 1780(4):733-742.
doi: 10.1016/j.bbagen.2007.12.010
[30] Sies H, Menck CF . Singlet oxygen induced DNA damage. Mutat Res. 1992; 275(3-6):367-375.
doi: 10.1016/0921-8734(92)90039-R
[31] Sies H . Damage to plasmid DNA by singlet oxygen and its protection. Mutat Res. 1993; 299(3-4):183-191.
doi: 10.1016/0165-1218(93)90095-U
[32] Yao XH, Min H, Lv ZM . Response of superoxide dismutase, catalase, and ATPase activity in bacteria exposed to acetamiprid. Biomed Environ Sci. 2006; 19(4):309-314.
[33] Imlay JA, Chin SM, Linn S . Toxic DNA damage by hydrogen peroxide through the Fenton reaction in vivo and in vitro. Science. 1988; 240(4852):640-642.
doi: 10.1126/science.2834821
[34] Chen JR, Weng CN, Ho TY, Cheng IC, Lai SS . Identification of the copper-zinc superoxide dismutase activity •m Mycoplasma hyopneumoniae . Vet Microbiol. 2000 ; 73(4) : 301-310.
doi: 10.1016/S0378-1135(99)00170-4
[35] Gerlach D, Reichardt W, Vettermann S . Extracellular superoxide dismutase from Streptococcus pyogenes type 12 strain is manganese-dependent. FEMS Microbiol Lett. 1998; 160(2) : 217-224.
doi: 10.1111/fml.1998.160.issue-2
[36] Jung S . Expression level of specific isozymes of maize catalase mutants influences other antioxidants on norflurazon- induced oxidative stress. Pestic Biochem Physiol. 2003; 75(1-2):9-17.
doi: 10.1016/S0048-3575(03)00017-8
[37] Khuda-Bukhsh AR . Towards understanding molecular mechanisms of action of homeopathic drugs: an overview. Mol Cell Biochem. 2003; 253(1-2):339-345.
doi: 10.1023/A:1026048907739
[38] Khuda-Bukhsh AR . Mice as a model for homeopathy research. Homeopathy. 2009; 98(4):267-279.
doi: 10.1016/j.homp.2009.09.007
[39] Mallick P, Mallick JC, Guha B, Khuda-Bukhsh AR . Ameliorating effect of microdoses of a potentized homeopathic drug, Arsenicum Album, on arsenic-induced toxicity in mice. BMC Complement Altern Med. 2003; 3:7.
doi: 10.1186/1472-6882-3-7
[40] Bhattacharyya SS, Mandal SK, Biswas R, Paul S, Pathak S, Boujedaini N, Belon P, Khuda-Bukhsh AR . In vitro studies demonstrate anticancer activity of an alkaloid of the plant Gelsemium sempervirens. Exp Biol Med (Maywood). 2008; 233(12):1591-1601.
doi: 10.3181/0805-RM-181
[1] Cai-lian Fana, Wan-jun Caib, Meng-nan Ye, Miao Chen, Yi Dai. Qili Qiangxin, a compound herbal medicine formula, alleviates hypoxia-reoxygenation-induced apoptotic and autophagic cell death via suppression of ROS/AMPK/mTOR pathway in vitro. Journal of Integrative Medicine, 2022, 20(4): 365-375.
[2] Ubiratan Cardinalli Adler, Maristela Schiabel Adler, Ana Elisa Madureira Padula, Livia Mitchiguian Hotta, Amarilysde Toledo Cesar, José Nelson Martins Diniz, Helen de Freitas Santos, Edson Zangiacomi Martinez. Homeopathy for COVID-19 in primary care: A randomized, double-blind, placebo-controlled trial (COVID-Simile study). Journal of Integrative Medicine, 2022, 20(3): 221-229.
[3] Mikhail Teppone. Medicine has always been “Modern” and “Scientific” from ancient times to the present day. Journal of Integrative Medicine, 2019, 17(4): 229-237.
[4] Bruno José Martins Da Silva, Sandro Wilson Gomes Pereira, Ana Paula Drummond Rodrigues, José Luiz Martins Do Nascimento, Edilene Oliveira Silva. In vitro antileishmanial effects of Physalis angulata root extract on Leishmania infantum. Journal of Integrative Medicine, 2018, 16(6): 404-410.
[5] Ubiratan Cardinalli Adler, Ana Carolina Acorinte, Fernando Oliveira Calzavara, Adriano Andréda Silva, Amarilys de Toledo Cesar, Maristela Schiabel Adler, Edson Zangiacomi Martinez, José Carlos Fernandes Galduróz. Double-blind evaluation of homeopathy on cocaine craving: A randomized controlled pilot study. Journal of Integrative Medicine, 2018, 16(3): 178-184.
[6] Shubha Singhal, Vandana Roy. Awareness, practice and views about integrating AYUSH in allopathic curriculum of allopathic doctors and interns in a tertiary care teaching hospital in New Delhi, India. Journal of Integrative Medicine, 2018, 16(2): 113-119.
[7] Bellavite Paolo, Marzotto Marta, Bonafini Clara. Arnica montana experimental studies: Confounders and biases?. Journal of Integrative Medicine, 2018, 16(2): 72-76.
[8] Salvatore Chirumbolo, Geir Bjørklund. Homeopathic potencies of Arnica montana L. change gene expression in a Tamm-Horsfall protein-1 cell line in vitro model: The role of ethanol as a possible confounder and statistical bias. Journal of Integrative Medicine, 2017, 15(4): 255-264.
[9] Saeed Ahmad, Tayyeba Rehman, Waheed Mumtaz Abbasi. Effects of homoeopathic ultrahigh dilutions of Aconitum napellus on Baker's yeast-induced fever in rabbits. Journal of Integrative Medicine, 2017, 15(3): 209-213.
[10] Roslinah Mohamad Hussain, Noor Faradilla Abdullah, Zulkhairi Amom. Killing of Staphylococcus aureus by allylpyrocatechol is potentiated by induction of intracellular oxidative stress and inhibition of catalase activity. Journal of Integrative Medicine, 2016, 14(6): 456-464.
[11] Yuki Takauji, Kyoko Morino, Kensuke Miki, Mohammad Hossain, Dai Ayusawa, Michihiko Fujii. Chyawanprash, a formulation of traditional Ayurvedic medicine, shows a protective effect on skin photoaging in hairless mice. Journal of Integrative Medicine, 2016, 14(6): 473-479.
[12] Jesmin Mondal, Asmita Samadder, Anisur Rahman Khuda-Bukhsh. Psorinum 6× triggers apoptosis signals in human lung cancer cells. Journal of Integrative Medicine, 2016, 14(2): 143-153.
[13] Santu Kumar Saha, Sourav Roy, Anisur Rahman Khuda-Bukhsh. Ultra-highly diluted plant extracts of Hydrastis canadensis and Marsdenia condurango induce epigenetic modifications and alter gene expression profiles in HeLa cells in vitro. Journal of Integrative Medicine, 2015, 13(6): 400-411.
[14] Subhranil Saha​, Munmun Koley​, Subhasish Ganguly​, Prasanta Rath​, Pulak Roy Chowdhury, Seikh Intaj Hossain. Developing the criteria for evaluating quality of individualization in homeopathic clinical trialreporting: A preliminary study. Journal of Integrative Medicine, 2014, 12(1): 13-19.
[15] Subhranil Saha​, Munmun Koley, Jogendra Singh Arya, Gurudev Choubey, Shubhamoy Ghosh​, Subhasish Ganguly​, Aloke Ghosh​, Sangita Saha​, Malay Mundle​. Medicine prescription practices of homeopathic undergraduate students in West Bengal, India. Journal of Integrative Medicine, 2014, 12(1): 7-12.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
[1] Wei-xiong Liang. Problems-solving strategies in clinical treatment guideline for traditional Chinese medicine and integrative medicine. Journal of Chinese Integrative Medicine, 2008, 6(1): 1-4
[2] Zhao-guo Li. Discussion on English translation of commonly used sentences in traditional Chinese medicine: part one. Journal of Chinese Integrative Medicine, 2008, 6(1): 107-110
[3] Jun Hu, Jian-ping Liu. Non-invasive physical treatments for chronic/recurrent headache. Journal of Chinese Integrative Medicine, 2008, 6(1): 31
[4] Xue-mei Liu, Qi-fu Huang, Yun-ling Zhang, Jin-li Lou, Hong-sheng Liu, Hong Zheng. Effects of Tribulus terrestris L. saponion on apoptosis of cortical neurons induced by hypoxia-reoxygenation in rats. Journal of Chinese Integrative Medicine, 2008, 6(1): 45-50
[5] . Uniform requirements for manuscripts submitted to biomedical journals: Writing and editing for biomedical publication (Chinese version, part two). Journal of Chinese Integrative Medicine, 2010, 8(11): 1001-1005
[6] Daniel Weber, Janelle M Wheat, Geoffrey M Currie. Inflammation and cancer: Tumor initiation, progression and metastasis,and Chinese botanical medicines. Journal of Chinese Integrative Medicine, 2010, 8(11): 1006-1013
[7] Hong Liu , Guo-liang Zhang, Li Shen , Zhen Zeng, Bao-luo Zhou, Cheng-hai Liu, Guang Nie . Application and evaluation of a pseudotyped virus assay for screening herbs for anti-H5Nl avian influenza virus. Journal of Chinese Integrative Medicine, 2010, 8(11): 1036-1040
[8] Zhao-guo Li . A discussion of English translation of 1995 and 1997 Chinese National Standards of Traditional Chinese Medical Terminologies for Clinical Diagnosis and Treatment. Journal of Chinese Integrative Medicine, 2010, 8(11): 1090-1096
[9] Rui Jin, Bing Zhang. A complexity analysis of Chinese herbal property theory: the multiple formations of herbal property (Part 1). Journal of Chinese Integrative Medicine, 2012, 10(11): 1198-1205
[10] Hui-min Liu, Xian-bo Wang, Yu-juan Chang, Li-li Gu. Systematic review and meta-analysis of randomized controlled trials of integrative medicine therapy for treatment of chronic severe hepatitis. Journal of Chinese Integrative Medicine, 2012, 10(11): 1211-1228
Journal of Integrative Medicine, ISSN: 2095-4964 CN 31-2083/R
Copyright © Journal of Integrative Medicine
Powered by Beijing Magtech Co. Ltd
沪公网安备31010602003416号      沪ICP备18017633号-3