[an error occurred while processing this directive]

Journal of Chinese Integrative Medicine ›› 2011, Vol. 9 ›› Issue (7): 752-760.doi: 10.3736/jcim20110709

• Original Experimental Research • Previous Articles     Next Articles

Potentized homeopathic drug Arsenicum Album 30C positively modulates protein biomarkers and gene expressions in Saccharomyces cerevisae exposed to arsenate

Durba Das1, Arnab De1, Suman Dutta1, Raktim Biswas1, Naoual Boujedaini2, Anisur Rahman Khuda-Bukhsh1()   

  1. 1. Cytogenetics and Molecular Biology Laboratory, Department of Zoology, University of Kalyani, Kalyani 741235, India
    2. Boiron Laboratory, Lyon, France
  • Received:2011-01-18 Accepted:2011-04-06 Online:2011-07-20 Published:2018-10-14
  • Supported by:
    This work has been financially supported by Boiron Laboratory, Leon, France

RichHTML

2

PDF (PC)

98

Like

Objective: This study examines if homeopathic drug Arsenicum Album 30C (Ars Alb 30C) can elicit ameliorative responses in yeast (Saccharomyces cerevisiae) exposed to arsenate.
Methods: The yeast S. cerevisiae 699 was cultured in a standard yeast extract peptone dextrose broth medium. It was exposed to the final concentration of 0.15 mmol/L arsenate for two intervals, 1 h and 2 h, respectively. The cell viability was determined along with the assessment of several toxicity biomarkers such as catalase (CAT), superoxide dismutase (SOD), total thiol (GSH) and glucose-6-phosphate dehydrogenase (G6PDH), lipid peroxidation, protein carbonylation and DNA damage. Reactive oxygen species (ROS) accumulation, expressions of relevant stress transcription activators like Yap-1 and Msn 2, and mRNA expression of yeast caspase-1 (Yca-1) were also measured.
Results: Treatment of arsenate increased lipid peroxidation, protein carbonylation, DNA damage, ROS accumulation and expressions of Yap-1, Msn 2 and Yca-1 and decreased GSH, G6PDH, CAT and SOD. Ars Alb 30C administration decreased lipid peroxidation, protein carbonylation, DNA damage, ROS formation and Msn 2 and Yca-1 expressions and increased cell viability, GSH, G6PDH, CAT and SOD significantly (P<0.05), except for a slight increase in Yap-1 expression.
Conclusion: Ars Alb 30C triggers ameliorative responses in S. cerevisiae exposed to arsenate.

Key words: Saccharomyces, arsenicals, homeopathy, reactive oxygen species, reverse transcriptase polymerase chain reaction

"

Primer Sequence
Yca-1 Forward: ATGTATCCAGGTAGTGGACGTTACACCTAC
Reverse: CTACATAATAAATTGCAGATTTACGTCAATAGG
G3PDH Forward: CCCACTAACATCAAATGGGG
Reverse: CCTTCCACAATGCAAAGTT

"

Group n Percentage of viable cells
(methylene blue staining)		 Percentage of viable cells
(MTT assay)
1 h 2 h 1 h 2 h
Normal control 9 98.270±0.730 98.660±0.667 100.000±0 100.000±0
Arsenate-treated 9 78.417±0.217 73.063±0.130 82.140±0.199 70.310±0.317
Positive control (Arsenate+placebo) 9 78.633±0.376 71.933±0.200 81.540±0.280 70.430±0.296
Drug-treated (Arsenate+Ars Alb 30C) 9 81.567±0.467* 76.240±0.229* 85.977±0.440* 74.467±0.740*

"

Group n Lipid peroxidation
(nmol/mg protein)		 Protein carbonylation
(ng/mg protein)		 GSH content
(μmol/L per 106 cells)
1 h
 2 h
 1h
 2 h
 1 h
 2 h
Normal control 9 0.041±0.001 0.068±0.001 903.3±3.3 968.6±10.6 2.723±0.020 2.790±0.003
Arsenate-treated 9 0.059±0 0.079±0.001 1718.7±3.6 2580.3±17.6 2.070±0.073 2.260±0.004
Positive control (Arsenate+placebo) 9 0.060±0.001 0.078±0.001 1722.7±6.3 2610.3±11.3 2.100±0.050 2.261±0.003
Drug-treated (Arsenate+Ars Alb 30C) 9 0.045±0.001* 0.073±0.001* 1299.3±0.7* 2271.0±6.1* 2.390±0.037* 2.470±0.028*

"

Group n CAT SOD G6PDH
1 h 2 h 1 h 2 h 1 h 2 h
Normal control 9 84.51±0.50 82.83±0.92 12.47±0.23 13.14±0.23 37.4±0.4 38.2±0.9
Arsenate-treated 9 70.51±0.25 65.10+0.25 9.11±0.05 10.53±0.03 20.9±0.1 18.9±0.9
Positive control (Arsenate+placebo) 9 70.67±0.16 64.90±0.17 9.2±0.20 10.57±0.01 20.7±0.3 18.8±1.0
Drug-treated (Arsenate+Ars Alb 30C) 9 77.70±0.60* 72.43±0.26* 10.22±0.22* 12.14±0.02* 28.7±1.2* 23.5±0.4*

Figure 1

Comet assay of cells in different groups (Light microscopy, ×200) Photographs of ethidium bromide-stained nuclei of control and treated cells under a fluorescence microscope after single cell gel electrophoresis. A: control; B: arsenate; C: arsenate plus placebo; D: arsenate plus Ars Alb 30C."

"

Group n Comet tail length (μm)
1 h 2 h
Normal control 9 79.40±0.30 79.30±0.38
Arsenate-treated 9 146.13±4.84 229.40±1.86
Positive control (Arsenate+placebo) 9 151.53±1.43 231.30±5.30
Drug-treated (Arsenate+Ars Alb 30C) 9 124.10±2.81* 169.03±8.96*

Figure 2

Chromatin condensation of cells in different groups (Light microscopy, ×400) Photographs of DAPI-stained cells of different control and treated groups under fluorescence microscope. A: control; B: arsenate; C: arsenate plus placebo; D: arsenic plus Ars Alb 30C. DAPI: 4′,6-diamidino-2-phenylindole."

Figure 3

Intracellular ROS accumulation FACS analysis of intracellular ROS produced by different control and treated yeast cells. A: control; B: arsenate; C: arsenate plus placebo; D: arsenate plus Ars Alb 30C. ROS: reactive oxygen species; FACS: fluorescence-activated cell sorting."

Figure 4

Expressions of Yap-1 and Msn 2 proteins tested by Western blotting A: Yap-1 expression after 1 h treatment; B: Yap-1 expression after 2 h treatment; C: Msn 2 expression after 1 h treatment; D: Msn 2 expression after 2 h treatment. Ln1: control; Ln2: arsenate; Ln3: arsenate plus placebo; Ln4: arsenate plus Ars Alb 30C."

Figure 5

Expression of Yca-1 tested by reverse transcription-polymerase chain reaction A: Yca-1 expression after 1 h treatment; B: Yca-1 expression after 2 h treatment; C: G3PDH housekeeping gene expression. Ln1: control; Ln2: arsenate; Ln3: arsenate plus placebo; Ln4: arsenate plus Ars Alb 30 C. Yca-1: yeast caspase-1; G3PDH: glucose-3-phosphate dehydrogenase."

[1] Khuda-Bukhsh AR, Pathak S . Homeopathic drug discovery: theory update and methodological aspect[J]. Expert Opin Drug Discov, 2008,3(8):979-990
doi: 10.1517/17460441.3.8.979 pmid: 23484971
[2] Khuda-Bukhsh AR . Laboratory research in homeopathy: pro[J]. Integr Cancer Ther, 2006,5(4):320-332
doi: 10.1177/1534735406294794 pmid: 17101761
[3] Belon P, Banerjee A, Karmakar SR, Biswas SJ, Choudhury SC, Banerjee P, Das JK, Pathak S, Guha B, Paul S, Bhattacharjee N, Khuda-Bukhsh AR . Homeopathic remedy for arsenic toxicity?: Evidence-based findings from a randomized placebo-controlled double blind human trial[J]. Sci Total Environ, 2007,384(1-3):141-150
doi: 10.1016/j.scitotenv.2007.06.001
[4] Barchowsky A, Roussel RR, Klei LR, James PE, Ganju N, Smith KR, Dudek EJ . Low levels of arsenic trioxide stimulate proliferative signals in primary vascular cells without activating stress effector pathways[J]. Toxicol Appl Pharmacol, 1999,159(1):65-75
doi: 10.1006/taap.1999.8723
[5] Chen YC, Lin-Shiau SY, Lin JK . Involvement of reactive oxygen species and caspase 3 activation in arsenite-induced apoptosis[J]. J Cell Physiol, 1998,177(2):324-333
doi: 10.1002/(ISSN)1097-4652
[6] Wang TS, Kuo CF, Jan KY, Huang H . Arsenite induces apoptosis in Chinese hamster ovary cells by generation of reactive oxygen species[J]. J Cell Physiol, 1996,169(2):256-268
doi: 10.1002/(ISSN)1097-4652
[7] Banerjee P, Biswas SJ, Belon P, Khuda-Bukhsh AR . A potentized homeopathic drug, Arsenicum Album 200, can ameliorate genotoxicity induced by repeated injections of arsenic trioxide in mice[J]. J Vet Med A Physiol Pathol Clin Med, 2007,54(7):370-376
doi: 10.1111/jva.2007.54.issue-7
[8] Datta S, Mallick P, Bukhsh AR . Efficacy of a potentized homoeopathic drug(Arsenicum Album-30) in reducing genotoxic effects produced by arsenic trioxide in mice: comparative studies of pre-, post- and combined pre- and post-oral administration and comparative efficacy of two microdoses[J]. Complement Ther Med, 1999,7(2):62-75
doi: 10.1016/S0965-2299(99)80084-3
[9] Banerjee P, Bhattacharyya SS, Bhattacharjee N, Pathak S, Boujedaini N, Belon P, Khuda-Bukhsh AR . Ascorbic acid combats arsenic-induced oxidative stress in mice liver[J]. Ecotoxicol Environ Saf, 2009,72(2):639-649
doi: 10.1016/j.ecoenv.2008.07.005 pmid: 18715643
[10] Mouriquand G, Cier A, Boiron J, Edel V, Chighizola R . Mobilization of fixed arsenic by the effect of infinitesimal doses & changes of the vestibular chronological index[J]. C R Hebd Seances Acad Sci, 1959,249(1):18-20
[11] Chikramane PS, Suresh AK, Bellare JR, Kane SG . Extreme homeopathic dilutions retain starting materials: a nanoparticulate perspective[J]. Homeopathy, 2010,99(4):231-242
doi: 10.1016/j.homp.2010.05.006 pmid: 20970092
[12] Boiron J, Abecassis J, Belon P. A pharmacological study of the retention and mobilization of arsenic, as caused by Hahnemanian potencies of Arsenicum Album. In: Boiron J, Abecassis J, Belon P. Aspects of research in homeopathy(Vol 1)[M]. Lyon: Boiron, 1983
[13] Betti L, Brizzi M, Nani D, Peruzzi M . A pilot statistical study with homoeopathic potencies of arsenicum album in wheat germination as a simple model[J]. Br Homeopath J, 1994,83(4):195-201
doi: 10.1016/S0007-0785(05)80791-4
[14] Lahnstein L, Binder M, Thurneysen A, Frei-Erb M, Betti L, Peruzzi M, Heusser P, Baumgartner S . Isopathic treatment effects of Arsenicum album 45× on wheat seedling growth — further reproduction trials[J]. Homeopathy, 2009,98(4):198-207
doi: 10.1016/j.homp.2009.09.011
[15] Jäger T, Scherr C, Wolf U, Simon M, Heusser P, Baumgartner S . Investigation of arsenic-stressed yeast(Saccharomyces cerevisiae) as a bioassay in homeopathic basic research[J]. ScientificWorldJournal, 2011,11:568-583
doi: 10.1100/tsw.2011.45
[16] Tepari R, Stuparevi I, Mrsa V . Increased mortality of Saccharomyces cerevisiae cell wall protein mutants[J]. Microbiology, 2004,150(Pt 10):3145-3150
doi: 10.1099/mic.0.27296-0 pmid: 15470095
[17] Aust SD. Thiobarbituric acid assay reactants. In: Tyson CA, Frazier ZM. Methods in toxicology. Vol 1B: In vitro toxity indicators[M]. New York: Academic Press, 1994: 367-376
[18] Lushchak V, Semchyshyn H, Mandryk S, Lushchak O . Possible role of superoxide dismutases in the yeast Saccharomyces cerevisiae under respiratory conditions[J]. Arch Biochem Biophys, 2005,441(1):35-40
doi: 10.1016/j.abb.2005.06.010
[19] Ellman GL . Tissue sulfhydryl groups.[J]. Arch Biochem Biophys, 1959,82(1):70-77
doi: 10.1016/0003-9861(59)90090-6
[20] Bradford MM . A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding[J]. Anal Biochem, 1976,72:248-254
doi: 10.1016/0003-2697(76)90527-3
[21] Maehly AC, Chance B. Assay of catalases and peroxidases. In: Colowick SP, Kaplan NO. Methods in enzymology. Vol 2: Preparation and assay of enzymes[M]. New York: Academic Press, 1955: 764-774
[22] Nishikimi M, Appaji N, Yagi K . The occurrence of superoxide anion in the reaction of reduced phenazine methosulfate and molecular oxygen[J]. Biochem Biophys Res Commun, 1972,46(2):849-854
doi: 10.1016/S0006-291X(72)80218-3
[23] Miloshev G, Mihaylov I, Anachkova B . Application of the single cell gel electrophoresis on yeast cells[J]. Mutat Res, 2002,513(1-2):69-74
doi: 10.1016/S1383-5718(01)00286-8 pmid: 11719091
[24] Linde K, Jonas WB, Melchart D, Worku F, Wagner H, Eitel F . Critical review and meta-analysis of serial agitated dilutions in experimental toxicology[J]. Hum Exp Toxicol, 1994,13(7):481-492
doi: 10.1177/096032719401300706 pmid: 7917505
[25] Scherr C, Baumgartner S, Spranger J, Simon M . Effects of potentised substances on growth kinetics of Saccharomyces cerevisiae and Schizosaccharomyces pombe[J]. Forsch Komplementmed, 2006,13(5):298-306
[26] Nyström T . Role of oxidative carbonylation in protein quality control and senescence[J]. EMBO J, 2005,24(7):1311-1317
doi: 10.1038/sj.emboj.7600599 pmid: 15775985
[27] Imlay JA, Linn S . DNA damage and oxygen radical toxicity[J]. Science, 1988,240(4857):1302-1309
doi: 10.1126/science.3287616
[28] Panda SK . Advances in stress physiology of plants[M]. Jodhpur: Scientific Publishers, 2002: 1-13
[29] Kuge S, Jones N, Nomoto A . Regulation of yAP-1 nuclear localization in response to oxidative stress[J]. EMBO J, 1997,16(7):1710-1720
doi: 10.1093/emboj/16.7.1710 pmid: 9130715
[30] Lee RE, Puente LG, Kaern M, Megeney LA . A non-death role of the yeast metacaspase: Yca1p alters cell cycle dynamics[J]. PLoS One, 2008,3(8):e2956
doi: 10.1371/journal.pone.0002956 pmid: 18698411
[1] Yue-hua Wang, Xiao-li He, Xiao-xiu Li, Hai-lin Qin, Guan-hua Du . Effects of the effective component group of Chinese herbal medicine Xiaoxuming Decoction on brain mitochondria in rats with chronic cerebral ischemia. Journal of Chinese Integrative Medicine, 2012, 10(5): 569-576.
[2] Soumya Sundar Bhattacharyya, Jayeeta Das, Sreemanti Das, Asmita Samadder, Durba Das, Arnab De, Saili Paul, Anisur Rahman Khuda-Bukhsh. Rapid green synthesis of silver nanoparticles from silver nitrate by a homeopathic mother tincture Phytolacca Decandra. Journal of Chinese Integrative Medicine, 2012, 10(5): 546-554.
[3] Santu Kumar Saha, Sreemanti Das, Anisur Rahman Khuda-Bukhsh. Phenotypic evidence of ultra-highly diluted homeopathic remedies acting at gene expression level: A novel probe on experimental phage infectivity in bacteria. Journal of Chinese Integrative Medicine, 2012, 10(4): 462-470.
[4] Das Sreemanti, Kumar Saha Santu, De Arnab, Das Durba, Rahman Khuda-Bukhsh Anisur. Potential of the homeopathic remedy, Arnica Montana 30C, to reduce DNA damage in Escherichia coli exposed to ultraviolet irradiation through up-regulation of nucleotide excision repair genes. Journal of Chinese Integrative Medicine, 2012, 10(3): 337-246.
[5] De Arnab, Das Durba, Dutta Suman, Chakraborty Debrup, Boujedaini Naoual, Rahman Khuda-Bukhsh Anisur. Potentized homeopathic drug Arsenicum Album 30C inhibits intracellular reactive oxygen species generation and up-regulates expression of arsenic resistance gene in arsenite-exposed bacteria Escherichia coli. Journal of Chinese Integrative Medicine, 2012, 10(2): 210-227.
[6] Xiao-ping Huang , Xiao-dan Liu , Chang-qing Deng . Effects of the combination of active component extracts from Astragalus membranaceus and Panax notoginseng on apoptosis, reactive oxygen species and mitochondrial membrane potential of PC12 cells with oxidative injury. Journal of Chinese Integrative Medicine, 2012, 10(10): 1127-1134.
[7] Anisur Rahman Khuda-Bukhsh, Arnab De, Durba Das, Suman Dutta, Naoual Boujedaini. Analysis of the capability of ultra-highly diluted glucose to increase glucose uptake in arsenite-stressed bacteria Escherichia coli. Journal of Chinese Integrative Medicine, 2011, 9(8): 901-912.
[8] Arndt Büssing, Thomas Ostermann, Peter Heusser, Peter F. Matthiessen. Usage of alternative medical systems,acupuncture, homeopathy and anthroposophic medicine, by older German adults. Journal of Chinese Integrative Medicine, 2011, 9(8): 847-856.
[9] Anisur Rahman Khuda-Bukhsh, Antara Banerjee, Surjyo Jyoti Biswas, Susanta Roy Karmakar, Pathikrit Banerjee, Surajit Pathak, Bibhas Guha, Saiful Haque, Debarsi Das, Arnab De, Durba Das, Naoual Boujedaini. An initial report on the efficacy of a millesimal potency Arsenicum Album LM 0/3 in ameliorating arsenic toxicity in humans living in a high-risk arsenic village. Journal of Chinese Integrative Medicine, 2011, 9(6): 596-604.
[10] Thanasekaran Jayakumar, Philip Aloysius Thomas, Mathivanan Isai, Pitchairaj Geraldine. An extract of the oyster mushroom, Pleurotus ostreatus, increases catalase gene expression and reduces protein oxidation during aging in rats. Journal of Chinese Integrative Medicine, 2010, 8(8): 774-780.
[11] Ying-hong Tang, Shu-ping Zhang, Yan Liang, Chang-qing Deng. Effects of Panax notoginseng saponins on mRNA expressions of interleukin-1β, its correlative factors and cysteinyl-aspartate specific protease after cerebral ischemia-reperfusion in rats. Journal of Chinese Integrative Medicine, 2007, 5(3): 328-332.
[12] Sheng Liu​, Xiao-hong Xue​, Xin-wei Yang​, De-ming Lu​. Effects of Runing Recipe medicated serum on expressions of genes in breast cancer cells. Journal of Chinese Integrative Medicine, 2006, 4(5): 490-494.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
[1] Jin-zhou Tian, Jing Shi, Xin-qing Zhang, Qi Bi, Xin Ma, Zhi-liang Wang, Xiao-bin Li, Shu-li Shen, Lin Li, Zhen-yun Wu, Li-yan Fang, Xiao-dong Zhao, Ying-chun Miao, Peng-wen Wang, Ying Ren, Jun-xiang Yin, Yong-yan Wang, Beijing United Study Group on MCI of the Capital Foundation of Medical Developments. An explanation on "guiding principles of clinical research on mild cognitive impairment (protocol)". Journal of Chinese Integrative Medicine, 2008, 6(1): 15-21
[2] Yi-ting He, Qing-lin Zha, Jian-ping Yu, Yong Tan, Cheng Lu, Ai-ping Lv. Principal factor analysis of symptoms of rheumatoid arthritis and their correlations with efficacy of traditional Chinese medicine and Western medicine. Journal of Chinese Integrative Medicine, 2008, 6(1): 32-36
[3] Jun Cai, Hua Wang, Sheng Zhou, Bin Wu, Hua-rong Song, Zheng-rong Xuan. Effect of Sijunzi Decoction and enteral nutrition on T-cell subsets and nutritional status in patients with gastric cancer after operation: A randomized controlled trial. Journal of Chinese Integrative Medicine, 2008, 6(1): 37-40
[4] Wei Zhang, Xiang-feng Lu, Xiao-mei Zhang, Jian-jun Wu, Liang-duo Jiang. A rat model of pulmonary fibrosis induced by infusing bleomycin quickly through tracheal intubation. Journal of Chinese Integrative Medicine, 2008, 6(1): 60-67
[5] A-gao Zhou, Yong Zhang, Gang Kui, De-Yun Kong, Hai-liang Ge, Qiu-hua Ren, Jia-rong Dong, Sheng Hong, Xu-ming Mao, Yin Wang, Hui-zheng Zhang, Shu-jun Wang. Influence of traditional Chinese compound recipes with different efficacy on body weight, tumor weight and immune function in H22 cancer-bearing mice. Journal of Chinese Integrative Medicine, 2008, 6(1): 77-82
[6] Guo-hong Yuan, Xiao-jing Pang, He-chao Ma. Synergic effects of Danggui Buxue Decoction in reducing toxicity of cytoxan in tumor-bearing mice. Journal of Chinese Integrative Medicine, 2008, 6(1): 83-88
[7] Li Zhou, Hong-xing Zhang, Ling-guang Liu, Wen-jun Wan. Effect of electro-acupuncture at Fenglong (GV 16) on nitric oxide and endothelin in rats with hyperlipidemia. Journal of Chinese Integrative Medicine, 2008, 6(1): 89-92
[8] Jin-zhou Tian, Jing Shi, Xin-qing Zhang, Qi Bi, Xin Ma, Zhi-liang Wang, Xiao-bin Li, Shu-li Shen, Lin Li, Zhen-yun Wu, Li-yan Fang, Xiao-dong Zhao, Ying-chun Miao, Peng-wen Wang, Ying Ren, Jun-xiang Yin, Yong-yan Wang, Beijing United Study Group on MCI of the Capital Foundation of Medical Developments. Guiding principles of clinical research on mild cognitive impairment (protocol). Journal of Chinese Integrative Medicine, 2008, 6(1): 9-14
[9] Xin-jun Wang, Ling-ling Wang . A mechanism of endogenous opioid peptides for rapid onset of acupuncture effect in treatment of depression. Journal of Chinese Integrative Medicine, 2010, 8(11): 1014-1017
[10] Bo Wang , Wei Yan , Li-hui Hou, Xiao-ke Wu. Disorder of Tiangui (kidney essence) and reproductive dysfunction in patients with polycystic ovary syndrome. Journal of Chinese Integrative Medicine, 2010, 8(11): 1018-1022
[an error occurred while processing this directive]