SUBSCRIBE
Search JIM Advanced Search

Journal of Chinese Integrative Medicine ›› 2011, Vol. 9 ›› Issue (8): 901-912.doi: 10.3736/jcim20110813

• Original Experimental Research • Previous Articles     Next Articles

Analysis of the capability of ultra-highly diluted glucose to increase glucose uptake in arsenite-stressed bacteria Escherichia coli

Anisur Rahman Khuda-Bukhsh1(), Arnab De1, Durba Das1, Suman Dutta1, Naoual Boujedaini2#br#   

  • Received:2011-02-25 Accepted:2011-04-21 Online:2011-08-20 Published:2011-08-15

RichHTML

1

PDF (PC)

55

Like

Objective: Whether ultra-highly diluted homeopathic remedies can affect living systems is questionable. Therefore, this study sees value in the analysis of whether homeopathically diluted glucose 30C has any effect on Escherichia coli exposed to arsenite stress.
Methods: E. coli were cultured to their log phase in standard Luria-Bertani medium and then treated with either 1 mmol/L or 2 mmol/L sodium arsenite, with or without supplementation of either 1% or 3% glucose, an ultra-highly diluted and agitated ethanolic solution (70%) of glucose (diluted 1060 times), glucose 30C or 70% ethanol (placebo) in the medium. Glucose uptake, specific activities of hexokinase and glucokinase, membrane potential, intracellular adenosine triphosphate (ATP) and expression of glucose permease in E. coli were analyzed at two different time intervals. Arsenic content in E. coli (intracellular) and in the spent medium (extracellular) was also determined.
Results: In arsenite-exposed E. coli, the glucose uptake increased along with decreases in the specific activities of hexokinase and glucokinase, intracellular ATP and membrane potential and an increase in the gene expression level of glucose permease. Glucose uptake increased further by addition of 1%, 3% or ultra-highly diluted glucose in the medium, but not by the placebo.
Conclusion: The results demonstrated the efficacy of the ultra-highly diluted and agitated glucose in mimicking the action of actual glucose supplementation and its ability to modulate expressions of hexokinase and glucokinase enzymes and glucose permease genes, thereby validating the efficacy of ultra-high dilutions used in homeopathy.

Key words: arsenites, glucose uptake, Escherichia coli, hexokinase, glucokinase, adenosine triphosphate, membrane potentials, homeopathy

Figure 1

E. coli growth curve under different doses of sodium arsenite"

"

Primer name Primer sequences (5′-3′)
G-3-PDH (house-keeping gene) Forward: CCCACTAACATCAAATGGGG
Reverse: CCTTCCACAATGCAAAGTT
ptsG (glucose permease) Forward: CGGCGCTGACCTGGTTCCTG
Reverse: ACGGAACCGCCTGCTTCTGC

"

Group n Glucose uptake
45 min 90 min
Normal control 9 4.17±0.70 0.53±0.04
Normal control+1% glucose 9 114.50±4.50* 27.00±5.00*
Normal control+3% glucose 9 115.00±3.50* 29.50±2.00*
Normal control+placebo 30C 9 1.74±0.60 0.29±0.08
Normal control+glucose 30C 9 4.46±0.40* 0.62±0.07*
1 mmol/L arsenite 9 7.56±0.90* 2.87±0.50*
1 mmol/L arsenite+placebo 30C 9 7.47±1.00 2.90±0.59
1 mmol/L arsenite+glucose 30C 9 8.20±1.00△ 3.12±0.40△
2 mmol/L arsenite 9 8.21±0.90* 3.10±0.25*
2 mmol/L arsenite+placebo 30C 9 8.12±1.00 2.98±0.50
2 mmol/L arsenite+glucose 30C 9 8.80±1.20▲ 3.45±0.50▲

"

Group n Activity of hexokinase
45 min 90 min
Normal control 9 0.058±0.006 0.045±0.004
Normal control+glucose 30C 9 0.054±0.004* 0.036±0.002*
1 mmol/L arsenite 9 0.023±0.003* 0.021±0.001*
1 mmol/L arsenite+placebo 30C 9 0.020±0.004 0.020±0.003
1 mmol/L arsenite+glucose 30C 9 0.017±0.003△ 0.015±0.005△
2 mmol/L arsenite 9 0.020±0.004* 0.017±0.002*
2 mmol/L arsenite+placebo 30C 9 0.020±0.002 0.016±0.002
2 mmol/L arsenite+glucose 30C 9 0.013±0.002▲ 0.013±0.003▲

"

Group n Activity of glucokinase
45 min 90 min
Normal control 9 0.068±0.005 0.042±0.005
Normal control+glucose 30C 9 0.060±0.002* 0.038±0.002*
1 mmol/L arsenite 9 0.009±0.001* 0.007±0.001*
1 mmol/L arsenite+placebo 30C 9 0.009±0.002 0.007±0.001
1 mmol/L arsenite+glucose 30C 9 0.008±0.002△ 0.003±0.001△
2 mmol/L arsenite 9 0.009±0.002* 0.006±0.001*
2 mmol/L arsenite+placebo 30C 9 0.009±0.002 0.006±0.001
2 mmol/L arsenite+glucose 30C 9 0.007±0.001▲ 0.003±0.002▲

"

Group n ATP measurement
45 min 90 min
Normal control 9 4.750±0.113 1.930±0.111
Normal control+glucose 30C 9 4.807±0.118* 1.995±0.115*
1 mmol/L arsenite 9 0.834±0.111* 0.579±0.115*
1 mmol/L arsenite+placebo 30C 9 0.834±0.115 0.575±0.113
1 mmol/L arsenite+glucose 30C 9 1.202±0.115△ 0.779±0.112△
2 mmol/L arsenite 9 0.819±0.115* 0.559±0.113*
2 mmol/L arsenite+placebo 30C 9 0.817±0.118 0.584±0.119
2 mmol/L arsenite+glucose 30C 9 1.776±0.115▲ 0.834±0.111▲

"

Group n Membrane potential
45 min 90 min
Normal control 9 68.80±2.00 94.10±2.65
Normal control+glucose 30C 9 54.50±1.45* 88.70±2.40*
1 mmol/L arsenite 9 33.50±1.25* 65.80±1.55*
1 mmol/L arsenite+placebo 30C 9 31.90±1.50 63.70±1.80
1 mmol/L arsenite+glucose 30C 9 15.80±1.60△ 48.80±1.69△
2 mmol/L arsenite 9 30.20±1.50* 62.70±1.90*
2 mmol/L arsenite+placebo 30C 9 28.70±1.95 61.10±2.00
2 mmol/L arsenite+glucose 30C 9 10.30±1.60▲ 44.70±1.60▲

Figure 2

Analysis of membrane potential by flow-cytometry Cell membrane potential was measured by a flow-cytometer after two different doses of sodium arsenite insult. A: Normal control cells; B: Glucose 30C-treated control cells; C: 1 mmol/L arsenite-treated cells; D: 2 mmol/L arsenite-treated cells; E: 1 mmol/L arsenite and placebo-treated cells; F: 2 mmol/L arsenite and placebo-treated cells; G: 1 mmol/L arsenite and glucose 30C-treated cells; H: 2 mmol/L arsenite and glucose 30C-treated cells."

Figure 3

Gene expression analysis by reverse transcriptase-polymerase chain reaction Arbitrary band intensities of ptsG (glucose permease gene) were analysed against the house keeping gene (G-3-PDH) under different conditions. (a) and (d) represent the expression of house keeping gene after 1 mmol/L and 2 mmol/L of sodium arsenite addition, respectively; (b) Expression of ptsG at 45 min after the addition of 1 mmol/L arsenite; (c) Expression of ptsG at 90 min after the addition of 1 mmol/L arsenite; (e) Expression of ptsG at 45 min after the addition of 2 mmol/L arsenite; (f) Expression of ptsG at 90 min after the addition of 2 mmol/L arsenite. The components of different lanes are: Ln1: Normal control cells; Ln2: Sodium arsenite-treated cells; Ln3: Sodium arsenite plus placebo-treated cells; Ln4: Sodium arsenite plus glucose 30C-treated cells; Ln5: Normal control plus glucose 30C-treated cells."

"

Group n Band intensity
45 min 90 min
Normal control 9 1.00±0.10 1.00±0.09
Normal control+glucose 30C 9 1.19±0.06* 1.31±0.09*
1 mmol/L arsenite 9 1.14±0.04* 1.16±0.07*
1 mmol/L arsenite+placebo 30C 9 1.04±0.08 1.03±0.06
1 mmol/L arsenite+glucose 30C 9 1.22±0.05△ 1.28±0.09△
2 mmol/L arsenite 9 1.12±0.10* 1.27±0.12*
2 mmol/L arsenite+placebo 30C 9 1.09±0.20 1.07±0.12
2 mmol/L arsenite+glucose 30C 9 1.41±0.12▲ 1.42±0.15▲

"

Group n Gene expression
45 min 90 min
Normal control 9 1.00±0.15 1.00±0.18
Normal control+glucose 30C 9 1.15±0.25* 1.56±0.88*
1 mmol/L arsenite 9 1.67±0.49* 4.11±0.89*
1 mmol/L arsenite+placebo 30C 9 1.50±0.49 3.18±1.25
1 mmol/L arsenite+glucose 30C 9 2.53±0.50△ 5.02±0.65△
2 mmol/L arsenite 9 3.83±0.20* 6.72±0.45*
2 mmol/L arsenite+placebo 30C 9 2.28±0.19 6.20±0.44
2 mmol/L arsenite+glucose 30C 9 4.75±0.50▲ 7.84±0.68▲

"

Group n Arsenic measurement
45 min 90 min
Normal control 9 196.67±17.0 227.32±20.0
Normal control+
glucose 30C		 9 218.90±21.0* 253.00±25.0*
1 mmol/L arsenite 9 295.79±23.0* 321.24±26.0*
1 mmol/L arsenite+
placebo 30C		 9 289.93±22.0 314.71±28.0
1 mmol/L arsenite+
glucose 30C		 9 337.50±22.0△ 356.80±27.5△
2 mmol/L arsenite 9 368.18±26.0* 419.05±32.0*
2 mmol/L arsenite+
placebo 30C		 9 364.92±25.0 413.83±30.5
2 mmol/L arsenite+
glucose 30C		 9 398.00±24.6▲ 445.80±31.8▲

"

Group n Arsenic measurement
45 min 90 min
Normal control 9 1.54±0.12 0.35±0.02
Normal control+
glucose 30C		 9 1.32±0.15* 0.22±0.05*
1 mmol/L arsenite 9 19.24±1.50* 2.79±0.80*
1 mmol/L arsenite+
placebo 30C		 9 19.62±1.80 2.81±0.70
1 mmol/L arsenite+
glucose 30C		 9 16.90±1.80△ 2.54±0.90△
2 mmol/L arsenite 9 22.04±2.34* 3.44±1.10*
2 mmol/L arsenite+
placebo 30C		 9 21.82±2.00 3.50±0.85
2 mmol/L arsenite+
glucose 30C		 9 20.40±2.12▲ 2.80±1.20▲
[1] Vickers AJ, Fisher P, Smith C, Wyllie SE, Rees R . Homeopathic Arnica 30× is ineffective for muscle soreness after long-distance running: a randomized, double-blind, placebo-controlled trial[J]. Clin J Pain, 1998,14(3):227-231
doi: 10.1097/00002508-199809000-00009
[2] Lewith GT, Watkins AD, Hyland ME, Shaw S, Broomfield JA, Dolan G, Holgate ST . Use of ultramolecular potencies of allergen to treat asthmatic people allergic to house dust mite: double blind randomised controlled clinical trial[J]. BMJ, 2002,324(7336):520
doi: 10.1136/bmj.324.7336.520
[3] Ernst E . A systematic review of systematic reviews of homeopathy[J]. Br J Clin Pharmacol, 2002,54(6):577-582
doi: 10.1046/j.1365-2125.2002.01699.x pmid: 1874503
[4] Shang A, Huwiler-Müntener K, Nartey L, Jüni P, Dörig S, Sterne JA, Pewsner D, Egger M .Are the clinical effects of homoeopathy placebo effects? Comparative study of placebo-controlled trials of homoeopathy and allopathy[J]. Lancet, 2005,366(9487):726-732
doi: 10.1016/S0140-6736(05)67177-2
[5] House of Commons Science and Technology Committee. Evidence check 2: homeopathy. Fourth report of session 2009-10: Report, together with formal minutes, oral and written evidence. London:The Stationery Office Limited. 2010
[6] Khuda-Bukhsh AR . Potentized homoeopathic drugs act through regulation of gene-expression: a hypojournal to explain their mechanism and pathways of action in vitro[J]. Complement Ther Med, 1997,59(1):43-46
[7] Khuda-Bukhsh AR . Towards understanding molecular mechanisms of action of homeopathic drugs: an overview[J]. Mol Cell Biochem, 2003,253(1-2):339-345
doi: 10.1023/A:1026048907739 pmid: 14619985
[8] Khuda-Bukhsh AR . Laboratory research in homeopathy: pro[J]. Integr Cancer Ther, 2006,5(4):320-332
doi: 10.1177/1534735406294794 pmid: 17101761
[9] Khuda-Bukhsh AR . Mice as a model for homeopathy research[J]. Homeopathy, 2009,98(4):267-279
doi: 10.1016/j.homp.2009.09.007 pmid: 19945679
[10] Le Gall T, Clermont O, Gouriou S, Picard B, Nassif X, Denamur E, Tenaillon O . Extraintestinal virulence is a coincidental by-product of commensalism in B2 phylogenetic group Escherichia coli strains[J]. Mol Biol Evol, 2007,24(11):2373-2384
doi: 10.1093/molbev/msm172
[11] Bhattacharjee H, Rosen BP. Arsenic metabolism in prokaryotic and eukaryotic microbes. In: Nies DH, Simon S. Molecular microbiology of heavy metals[M]. Berlin: Springer, 2007: 371
[12] Lin YF, Yang J, Rosen BP . ArsD residues Cys 12, Cys 13, and Cys 18 form an As(Ⅲ)-binding site required for arsenic metallochaperone activity [J]. J Biol Chem, 2007,282(23):16783-16791
doi: 10.1074/jbc.M700886200
[13] Lin YF, Yang J, Rosen BP . ArsD: an As(Ⅲ) metallochaperone for the ArsAB As(Ⅲ)-translocating ATPase[J]. J Bioenerg Biomembr, 2007,39(5-6):453-458
doi: 10.1007/s10863-007-9113-y pmid: 17955352
[14] Xu C, Rosen BP. Metalloregulation of soft metal resistance pumps. In: Sarkar B. Metals and genetics[M]. New York: Plenum Press, 1999: 5-19
[15] San Francisco MJ, Tisa LS, Rosen BP . Identification of the membrane component of the anion pump encoded by the arsenical resistance operon of R-factor R773[J]. Mol Microbiol, 1989,3(1):15-21
doi: 10.1111/mmi.1989.3.issue-1
[16] Tisa LS, Rosen BP . Molecular characterization of an anion pump. The ArsB protein is the membrane anchor for the ArsA protein[J]. J Biol Chem, 1990,265(1):190-194
[17] Rosen BP, Weigel U, Karkaria C, Gangola P . Molecular characterization of an anion pump. The arsA gene product is an arsenate(antimonate)-stimulated ATPase[J]. J Biol Chem, 1988,263(7):3067-3070
[18] Dey S, Dou D, Rosen BP . ATP-dependent arsenite transport in everted membrane vesicles of Escherichia coli[J]. J Biol Chem, 1994,269(4):25442-25446
[19] Yu MH. Environmental toxicology: biological and health effects of pollutants(2nd ed)[M]. Boca Raton: CRC Press,2005,(2nd ed):
[20] Mokrasch LC . Analysis of hexose phosphates and sugar mixtures with the anthrone reagent[J]. J Biol Chem, 1954,208(1):55-59
doi: 10.2307/2485221 pmid: 13174514
[21] Racker E . Spectrophotometric measurement of hexokinase and phosphohexokinase activity[J]. J Biol Chem, 1947,167(3):843-854
pmid: 20287918
[22] Storer AC, Cornish-Bowden A . The kinetics of coupled enzyme reactions. Applications to the assay of glucokinase, with glucose 6-phosphate dehydrogenase as coupling enzyme[J]. Biochem J, 1974,141(1):205-209
doi: 10.1042/bj1410205
[23] Kangas L, Grönroos M, Nieminen AL . Bioluminescence of cellular ATP: a new method for evaluating cytotoxic agents in vitro[J]. Med Biol, 1984,62(6):338-343
doi: 10.1016/0024-3205(84)90053-5 pmid: 6543460
[24] Ingram PR, Pitt AR, Wilson CG, Olejnik O, Spickett CM . A comparison of the effects of ocular preservatives on mammalian and microbial ATP and glutathione levels[J]. Free Radic Res, 2004,38(7):739-750
doi: 10.1080/10715760410001712773
[25] O’Keefe D, Collier RJ . Cloned diphtheria toxin within the periplasm of Escherichia coli causes lethal membrane damage at low pH[J]. Proc Natl Acad Sci U S A, 1989,86(1):343-346
doi: 10.1073/pnas.86.1.343
[26] Amor KB, Breeuwer P, Verbaarschot P, Rombouts FM, Akkermans AD, De Vos WM, Abee T . Multiparametric flow cytometry and cell sorting for the assessment of viable, injured, and dead bifidobacterium cells during bile salt stress[J]. Appl Environ Microbiol, 2002,68(11):5209-5216
doi: 10.1128/AEM.68.11.5209-5216.2002
[27] Sims PJ, Waggoner AS, Wang CH, Hoffman JF . Studies on the mechanism by which cyanine dyes measure membrane potential in red blood cells and phosphatidylcholine vesicles[J]. Biochemistry, 1974,13(16):3315-3330
doi: 10.1021/bi00713a022
[28] Chowdhury R, Dutta A, Chaudhuri SR, Sharma N, Giri AK, Chaudhuri K . In vitro and in vivo reduction of sodium arsenite induced toxicity by aqueous garlic extract[J]. Food Chem Toxicol, 2008,46(2):740-751
doi: 10.1016/j.fct.2007.09.108 pmid: 17983699
[29] Bagchi P, Dutta D, Chattopadhyay S, Mukherjee A, Halder UC, Sarkar S, Kobayashi N, Komoto S, Taniguchi K, Chawla-Sarkar M . Rotavirus nonstructural protein 1 suppresses virus-induced cellular apoptosis to facilitate viral growth by activating the cell survival pathways during early stages of infection[J]. J Virol, 2010,84(13):6834-6845
doi: 10.1128/JVI.00225-10
[30] Behari JR, Prakash R . Determination of total arsenic content in water by atomic absorption spectroscopy(AAS) using vapour generation assembly(VGA)[J]. Chemosphere, 2006,63(1):17-21
doi: 10.1016/j.chemosphere.2005.07.073
[31] Sato T, Kobayashi Y . The ars operon in the skin element of Bacillus subtilis confers resistance to arsenate and arsenite[J]. J Bacteriol, 1998,180(7):1655-1661
[32] Rosen BP . Biochemistry of arsenic detoxification[J]. FEBS Lett, 2002,529(1):86-92
doi: 10.1016/S0014-5793(02)03186-1
[33] Panja S, Saha S, Jana B, Basu T . Role of membrane potential on artificial transformation of E. coli with plasmid DNA[J]. J Biotechnol, 2006,127(1):14-20
doi: 10.1016/j.jbiotec.2006.06.008 pmid: 16876281
[34] Elia V, Napoli E, Germano R . The ‘Memory of Water’: an almost deciphered enigma. Dissipative structures in extremely dilute aqueous solutions[J]. Homeopathy, 2007,96(3):163-169
doi: 10.1016/j.homp.2007.05.007
[35] Rey L . Thermoluminescence of ultra-high dilutions of lithium chloride and sodium chloride[J]. Physica A, 2003,323:67-74
doi: 10.1016/S0378-4371(03)00047-5
[36] Lo SY, Bonavida B. A book containing a dozen experiments using IE crystals. In: Lo SY, Bonavida B. Proceeding of the first international symposium on physical, chemical and biological properties of stable water (IE) clusters. Singapore City: World Scientific. 1998: 81-90
[37] Anagnostatos GS, Pissis P, Viras K, Soutzidou M. Theory and experiments on high dilutions. In: Ernst E, Hahn EG. Homeopathy: a critical appraisal. Oxford: Butterworth-Heinemann. 1998: 153-166
[38] Rao ML, Roy R, Bell IR, Hoover R . The defining role of structure(including epitaxy) in the plausibility of homeopathy[J]. Homeopathy, 2007,96(3):175-182
doi: 10.1016/j.homp.2007.03.009 pmid: 17678814
[39] Weingärtner O . The nature of the active ingredient in ultramolecular dilutions[J]. Homeopathy, 2007,96(3):220-226
doi: 10.1016/j.homp.2007.05.005 pmid: 17678820
[40] Milgrom LR . Conspicuous by its absence: the memory of water, macro-entanglement, and the possibility of homeopathy[J]. Homeopathy, 2007,96(3):209-219
doi: 10.1016/j.homp.2007.05.002
[41] Bellavite P, Signorini A . The emerging science of homeopathy: complexity, biodynamics, and nanopharmacology(2nd ed)[M]. Berkeley: North Atlantic Books, 2002,( 2nd ed):408
[42] Anick DJ, Ives JA . The silica hypojournal for homeopathy: physical chemistry[J]. Homeopathy, 2007,96(3):189-195
doi: 10.1016/j.homp.2007.03.005 pmid: 17678816
[43] Center of Conciousness Studies, The University of Arizona. Proceedings of the eighteenth annual international, interdisciplinary conference on the fundamental question of how the brain produces conscious experience. Stockholm, Sweden, May 3-7, 2011
[44] Davenas E, Beauvais F, Amara J, Oberbaum M, Robinzon B, Miadonna A, Tedeschi A, Pomeranz B, Fortner P, Belon P . Human basophil degranulation triggered by very dilute antiserum against IgE[J]. Nature, 1988,333(6176):816-818
doi: 10.1038/333816a0 pmid: 2455231
[1] Ubiratan Cardinalli Adler, Maristela Schiabel Adler, Ana Elisa Madureira Padula, Livia Mitchiguian Hotta, Amarilysde Toledo Cesar, José Nelson Martins Diniz, Helen de Freitas Santos, Edson Zangiacomi Martinez. Homeopathy for COVID-19 in primary care: A randomized, double-blind, placebo-controlled trial (COVID-Simile study). Journal of Integrative Medicine, 2022, 20(3): 221-229.
[2] Mikhail Teppone. Medicine has always been “Modern” and “Scientific” from ancient times to the present day. Journal of Integrative Medicine, 2019, 17(4): 229-237.
[3] Ubiratan Cardinalli Adler, Ana Carolina Acorinte, Fernando Oliveira Calzavara, Adriano Andréda Silva, Amarilys de Toledo Cesar, Maristela Schiabel Adler, Edson Zangiacomi Martinez, José Carlos Fernandes Galduróz. Double-blind evaluation of homeopathy on cocaine craving: A randomized controlled pilot study. Journal of Integrative Medicine, 2018, 16(3): 178-184.
[4] Shubha Singhal, Vandana Roy. Awareness, practice and views about integrating AYUSH in allopathic curriculum of allopathic doctors and interns in a tertiary care teaching hospital in New Delhi, India. Journal of Integrative Medicine, 2018, 16(2): 113-119.
[5] Salvatore Chirumbolo, Geir Bjørklund. Homeopathic potencies of Arnica montana L. change gene expression in a Tamm-Horsfall protein-1 cell line in vitro model: The role of ethanol as a possible confounder and statistical bias. Journal of Integrative Medicine, 2017, 15(4): 255-264.
[6] Jeremiah Olorunjuwon Olugbami, Robert Damoiseaux, Bryan France, Michael A. Gbadegesin, Adam Z. Stieg, Shivani Sharma, Oyeronke A. Odunola, James K. Gimzewski. Atomic force microscopy correlates antimetastatic potentials of HepG2 cell line with its redox/energy status: Effects of curcumin and Khaya senegalensis. Journal of Integrative Medicine, 2017, 15(3): 214-230.
[7] Saeed Ahmad, Tayyeba Rehman, Waheed Mumtaz Abbasi. Effects of homoeopathic ultrahigh dilutions of Aconitum napellus on Baker's yeast-induced fever in rabbits. Journal of Integrative Medicine, 2017, 15(3): 209-213.
[8] Jesmin Mondal, Asmita Samadder, Anisur Rahman Khuda-Bukhsh. Psorinum 6× triggers apoptosis signals in human lung cancer cells. Journal of Integrative Medicine, 2016, 14(2): 143-153.
[9] Santu Kumar Saha, Sourav Roy, Anisur Rahman Khuda-Bukhsh. Ultra-highly diluted plant extracts of Hydrastis canadensis and Marsdenia condurango induce epigenetic modifications and alter gene expression profiles in HeLa cells in vitro. Journal of Integrative Medicine, 2015, 13(6): 400-411.
[10] Subhranil Saha​, Munmun Koley​, Subhasish Ganguly​, Prasanta Rath​, Pulak Roy Chowdhury, Seikh Intaj Hossain. Developing the criteria for evaluating quality of individualization in homeopathic clinical trialreporting: A preliminary study. Journal of Integrative Medicine, 2014, 12(1): 13-19.
[11] Subhranil Saha​, Munmun Koley, Jogendra Singh Arya, Gurudev Choubey, Shubhamoy Ghosh​, Subhasish Ganguly​, Aloke Ghosh​, Sangita Saha​, Malay Mundle​. Medicine prescription practices of homeopathic undergraduate students in West Bengal, India. Journal of Integrative Medicine, 2014, 12(1): 7-12.
[12] Munmun Koley, Subhranil Saha, Jogendra Singh Arya, Gurudev Choubey, Shubhamoy Ghosh, Rajib Purkait, Ramkumar Mondal, Bapi Kundu, Rajarshi Mukherjee. A study on drug utilization and prescription habits of physicians in a government homeopathic hospital in West Bengal, India. Journal of Chinese Integrative Medicine, 2013, 11(5): 305-313.
[13] Soumya Sundar Bhattacharyya, Jayeeta Das, Sreemanti Das, Asmita Samadder, Durba Das, Arnab De, Saili Paul, Anisur Rahman Khuda-Bukhsh. Rapid green synthesis of silver nanoparticles from silver nitrate by a homeopathic mother tincture Phytolacca Decandra. Journal of Chinese Integrative Medicine, 2012, 10(5): 546-554.
[14] Santu Kumar Saha, Sreemanti Das, Anisur Rahman Khuda-Bukhsh. Phenotypic evidence of ultra-highly diluted homeopathic remedies acting at gene expression level: A novel probe on experimental phage infectivity in bacteria. Journal of Chinese Integrative Medicine, 2012, 10(4): 462-470.
[15] Das Sreemanti, Kumar Saha Santu, De Arnab, Das Durba, Rahman Khuda-Bukhsh Anisur. Potential of the homeopathic remedy, Arnica Montana 30C, to reduce DNA damage in Escherichia coli exposed to ultraviolet irradiation through up-regulation of nucleotide excision repair genes. Journal of Chinese Integrative Medicine, 2012, 10(3): 337-246.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
[1] Jin-rong Fu. Establishment of multivariate diagnosis and treatment system of modern gynecology of traditional Chinese medicine. Journal of Chinese Integrative Medicine, 2008, 6(1): 22-24
[2] Hao Li, Ming-jiang Yao, Wen-ming Zhao, Jie Guan, Lin-lin Cai, Ling Cui. A randomized, controlled, double-blind trial of Huannao Yicong capsule in senile patients with mild cognitive impairment. Journal of Chinese Integrative Medicine, 2008, 6(1): 25-31
[3] Zhi-chun Jin. Problems in establishing clinical guideline for integrated traditional Chinese and Western medicine. Journal of Chinese Integrative Medicine, 2008, 6(1): 5-8
[4] SUN Ming-yu, ZUO Jian, DUAN Ji-feng, HAN Jun, FAN Shi-ming, ZHANG Wei, ZHU Li-fang, YAO Ming-hui. Antitumor activities of kushen flavonoids in vivo and in vitro. Journal of Chinese Integrative Medicine, 2008, 6(1): 51-59
[5] Min Cheng, Qiong Feng, Shu-wen Qian, Hui Gao, Cui-qing Zhu. Preliminary assay of p-amyloid binding elements in heart-beneficial recipe. Journal of Chinese Integrative Medicine, 2008, 6(1): 68-72
[6] Ning-qun Wang, Liang-duo Jiang, Zong-xing Li. Research progress in asthma-related quality of life. Journal of Chinese Integrative Medicine, 2008, 6(1): 93-97
[7] Jing-yuan Mao, Chang-xiao Liu, Heng-he Wang, Guang-li Wei , Zhen-peng Zhang, Jie Xing, Wang Xian liang , Ying-fei Bi . Effects of Shenmai Injection on serum concentration and pharmacokinetics of digoxin in dogs with heart failure. Journal of Chinese Integrative Medicine, 2010, 8(11): 1070-1074
[8] Zhi-mei Wang, Bin Zhang. A study on translation of ellipses in Huangdi Neijing from perspective of hermeneutic theory. Journal of Chinese Integrative Medicine, 2010, 8(11): 1097-1100
[9] Gui Yu, Jie Wang. Thinking on building the network cardiovasology of Chinese medicine. Journal of Chinese Integrative Medicine, 2012, 10(11): 1206-1210
[10] Pedro Saganha João, Doenitz Christoph, Greten Tobias, Efferth Thomas, J. Greten Henry. Qigong therapy for physiotherapists suffering from burnout: a preliminary study. Journal of Chinese Integrative Medicine, 2012, 10(11): 1233-1239
Journal of Integrative Medicine, ISSN: 2095-4964 CN 31-2083/R
Copyright © Journal of Integrative Medicine
Powered by Beijing Magtech Co. Ltd
沪公网安备31010602003416号      沪ICP备18017633号-3