SUBSCRIBE
Search JIM Advanced Search

Journal of Chinese Integrative Medicine ›› 2011, Vol. 9 ›› Issue (7): 752-760.doi: 10.3736/jcim20110709

• Original Experimental Research • Previous Articles     Next Articles

Potentized homeopathic drug Arsenicum Album 30C positively modulates protein biomarkers and gene expressions in Saccharomyces cerevisae exposed to arsenate

Durba Das1, Arnab De1, Suman Dutta1, Raktim Biswas1, Naoual Boujedaini2, Anisur Rahman Khuda-Bukhsh1()   

  1. 1. Cytogenetics and Molecular Biology Laboratory, Department of Zoology, University of Kalyani, Kalyani 741235, India
    2. Boiron Laboratory, Lyon, France
  • Received:2011-01-18 Accepted:2011-04-06 Online:2011-07-20 Published:2018-10-14
  • Supported by:
    This work has been financially supported by Boiron Laboratory, Leon, France

RichHTML

2

PDF (PC)

81

Like

Objective: This study examines if homeopathic drug Arsenicum Album 30C (Ars Alb 30C) can elicit ameliorative responses in yeast (Saccharomyces cerevisiae) exposed to arsenate.
Methods: The yeast S. cerevisiae 699 was cultured in a standard yeast extract peptone dextrose broth medium. It was exposed to the final concentration of 0.15 mmol/L arsenate for two intervals, 1 h and 2 h, respectively. The cell viability was determined along with the assessment of several toxicity biomarkers such as catalase (CAT), superoxide dismutase (SOD), total thiol (GSH) and glucose-6-phosphate dehydrogenase (G6PDH), lipid peroxidation, protein carbonylation and DNA damage. Reactive oxygen species (ROS) accumulation, expressions of relevant stress transcription activators like Yap-1 and Msn 2, and mRNA expression of yeast caspase-1 (Yca-1) were also measured.
Results: Treatment of arsenate increased lipid peroxidation, protein carbonylation, DNA damage, ROS accumulation and expressions of Yap-1, Msn 2 and Yca-1 and decreased GSH, G6PDH, CAT and SOD. Ars Alb 30C administration decreased lipid peroxidation, protein carbonylation, DNA damage, ROS formation and Msn 2 and Yca-1 expressions and increased cell viability, GSH, G6PDH, CAT and SOD significantly (P<0.05), except for a slight increase in Yap-1 expression.
Conclusion: Ars Alb 30C triggers ameliorative responses in S. cerevisiae exposed to arsenate.

Key words: Saccharomyces, arsenicals, homeopathy, reactive oxygen species, reverse transcriptase polymerase chain reaction

"

Primer Sequence
Yca-1 Forward: ATGTATCCAGGTAGTGGACGTTACACCTAC
Reverse: CTACATAATAAATTGCAGATTTACGTCAATAGG
G3PDH Forward: CCCACTAACATCAAATGGGG
Reverse: CCTTCCACAATGCAAAGTT

"

Group n Percentage of viable cells
(methylene blue staining)		 Percentage of viable cells
(MTT assay)
1 h 2 h 1 h 2 h
Normal control 9 98.270±0.730 98.660±0.667 100.000±0 100.000±0
Arsenate-treated 9 78.417±0.217 73.063±0.130 82.140±0.199 70.310±0.317
Positive control (Arsenate+placebo) 9 78.633±0.376 71.933±0.200 81.540±0.280 70.430±0.296
Drug-treated (Arsenate+Ars Alb 30C) 9 81.567±0.467* 76.240±0.229* 85.977±0.440* 74.467±0.740*

"

Group n Lipid peroxidation
(nmol/mg protein)		 Protein carbonylation
(ng/mg protein)		 GSH content
(μmol/L per 106 cells)
1 h
 2 h
 1h
 2 h
 1 h
 2 h
Normal control 9 0.041±0.001 0.068±0.001 903.3±3.3 968.6±10.6 2.723±0.020 2.790±0.003
Arsenate-treated 9 0.059±0 0.079±0.001 1718.7±3.6 2580.3±17.6 2.070±0.073 2.260±0.004
Positive control (Arsenate+placebo) 9 0.060±0.001 0.078±0.001 1722.7±6.3 2610.3±11.3 2.100±0.050 2.261±0.003
Drug-treated (Arsenate+Ars Alb 30C) 9 0.045±0.001* 0.073±0.001* 1299.3±0.7* 2271.0±6.1* 2.390±0.037* 2.470±0.028*

"

Group n CAT SOD G6PDH
1 h 2 h 1 h 2 h 1 h 2 h
Normal control 9 84.51±0.50 82.83±0.92 12.47±0.23 13.14±0.23 37.4±0.4 38.2±0.9
Arsenate-treated 9 70.51±0.25 65.10+0.25 9.11±0.05 10.53±0.03 20.9±0.1 18.9±0.9
Positive control (Arsenate+placebo) 9 70.67±0.16 64.90±0.17 9.2±0.20 10.57±0.01 20.7±0.3 18.8±1.0
Drug-treated (Arsenate+Ars Alb 30C) 9 77.70±0.60* 72.43±0.26* 10.22±0.22* 12.14±0.02* 28.7±1.2* 23.5±0.4*

Figure 1

Comet assay of cells in different groups (Light microscopy, ×200) Photographs of ethidium bromide-stained nuclei of control and treated cells under a fluorescence microscope after single cell gel electrophoresis. A: control; B: arsenate; C: arsenate plus placebo; D: arsenate plus Ars Alb 30C."

"

Group n Comet tail length (μm)
1 h 2 h
Normal control 9 79.40±0.30 79.30±0.38
Arsenate-treated 9 146.13±4.84 229.40±1.86
Positive control (Arsenate+placebo) 9 151.53±1.43 231.30±5.30
Drug-treated (Arsenate+Ars Alb 30C) 9 124.10±2.81* 169.03±8.96*

Figure 2

Chromatin condensation of cells in different groups (Light microscopy, ×400) Photographs of DAPI-stained cells of different control and treated groups under fluorescence microscope. A: control; B: arsenate; C: arsenate plus placebo; D: arsenic plus Ars Alb 30C. DAPI: 4′,6-diamidino-2-phenylindole."

Figure 3

Intracellular ROS accumulation FACS analysis of intracellular ROS produced by different control and treated yeast cells. A: control; B: arsenate; C: arsenate plus placebo; D: arsenate plus Ars Alb 30C. ROS: reactive oxygen species; FACS: fluorescence-activated cell sorting."

Figure 4

Expressions of Yap-1 and Msn 2 proteins tested by Western blotting A: Yap-1 expression after 1 h treatment; B: Yap-1 expression after 2 h treatment; C: Msn 2 expression after 1 h treatment; D: Msn 2 expression after 2 h treatment. Ln1: control; Ln2: arsenate; Ln3: arsenate plus placebo; Ln4: arsenate plus Ars Alb 30C."

Figure 5

Expression of Yca-1 tested by reverse transcription-polymerase chain reaction A: Yca-1 expression after 1 h treatment; B: Yca-1 expression after 2 h treatment; C: G3PDH housekeeping gene expression. Ln1: control; Ln2: arsenate; Ln3: arsenate plus placebo; Ln4: arsenate plus Ars Alb 30 C. Yca-1: yeast caspase-1; G3PDH: glucose-3-phosphate dehydrogenase."

[1] Khuda-Bukhsh AR, Pathak S . Homeopathic drug discovery: theory update and methodological aspect[J]. Expert Opin Drug Discov, 2008,3(8):979-990
doi: 10.1517/17460441.3.8.979 pmid: 23484971
[2] Khuda-Bukhsh AR . Laboratory research in homeopathy: pro[J]. Integr Cancer Ther, 2006,5(4):320-332
doi: 10.1177/1534735406294794 pmid: 17101761
[3] Belon P, Banerjee A, Karmakar SR, Biswas SJ, Choudhury SC, Banerjee P, Das JK, Pathak S, Guha B, Paul S, Bhattacharjee N, Khuda-Bukhsh AR . Homeopathic remedy for arsenic toxicity?: Evidence-based findings from a randomized placebo-controlled double blind human trial[J]. Sci Total Environ, 2007,384(1-3):141-150
doi: 10.1016/j.scitotenv.2007.06.001
[4] Barchowsky A, Roussel RR, Klei LR, James PE, Ganju N, Smith KR, Dudek EJ . Low levels of arsenic trioxide stimulate proliferative signals in primary vascular cells without activating stress effector pathways[J]. Toxicol Appl Pharmacol, 1999,159(1):65-75
doi: 10.1006/taap.1999.8723
[5] Chen YC, Lin-Shiau SY, Lin JK . Involvement of reactive oxygen species and caspase 3 activation in arsenite-induced apoptosis[J]. J Cell Physiol, 1998,177(2):324-333
doi: 10.1002/(ISSN)1097-4652
[6] Wang TS, Kuo CF, Jan KY, Huang H . Arsenite induces apoptosis in Chinese hamster ovary cells by generation of reactive oxygen species[J]. J Cell Physiol, 1996,169(2):256-268
doi: 10.1002/(ISSN)1097-4652
[7] Banerjee P, Biswas SJ, Belon P, Khuda-Bukhsh AR . A potentized homeopathic drug, Arsenicum Album 200, can ameliorate genotoxicity induced by repeated injections of arsenic trioxide in mice[J]. J Vet Med A Physiol Pathol Clin Med, 2007,54(7):370-376
doi: 10.1111/jva.2007.54.issue-7
[8] Datta S, Mallick P, Bukhsh AR . Efficacy of a potentized homoeopathic drug(Arsenicum Album-30) in reducing genotoxic effects produced by arsenic trioxide in mice: comparative studies of pre-, post- and combined pre- and post-oral administration and comparative efficacy of two microdoses[J]. Complement Ther Med, 1999,7(2):62-75
doi: 10.1016/S0965-2299(99)80084-3
[9] Banerjee P, Bhattacharyya SS, Bhattacharjee N, Pathak S, Boujedaini N, Belon P, Khuda-Bukhsh AR . Ascorbic acid combats arsenic-induced oxidative stress in mice liver[J]. Ecotoxicol Environ Saf, 2009,72(2):639-649
doi: 10.1016/j.ecoenv.2008.07.005 pmid: 18715643
[10] Mouriquand G, Cier A, Boiron J, Edel V, Chighizola R . Mobilization of fixed arsenic by the effect of infinitesimal doses & changes of the vestibular chronological index[J]. C R Hebd Seances Acad Sci, 1959,249(1):18-20
[11] Chikramane PS, Suresh AK, Bellare JR, Kane SG . Extreme homeopathic dilutions retain starting materials: a nanoparticulate perspective[J]. Homeopathy, 2010,99(4):231-242
doi: 10.1016/j.homp.2010.05.006 pmid: 20970092
[12] Boiron J, Abecassis J, Belon P. A pharmacological study of the retention and mobilization of arsenic, as caused by Hahnemanian potencies of Arsenicum Album. In: Boiron J, Abecassis J, Belon P. Aspects of research in homeopathy(Vol 1)[M]. Lyon: Boiron, 1983
[13] Betti L, Brizzi M, Nani D, Peruzzi M . A pilot statistical study with homoeopathic potencies of arsenicum album in wheat germination as a simple model[J]. Br Homeopath J, 1994,83(4):195-201
doi: 10.1016/S0007-0785(05)80791-4
[14] Lahnstein L, Binder M, Thurneysen A, Frei-Erb M, Betti L, Peruzzi M, Heusser P, Baumgartner S . Isopathic treatment effects of Arsenicum album 45× on wheat seedling growth — further reproduction trials[J]. Homeopathy, 2009,98(4):198-207
doi: 10.1016/j.homp.2009.09.011
[15] Jäger T, Scherr C, Wolf U, Simon M, Heusser P, Baumgartner S . Investigation of arsenic-stressed yeast(Saccharomyces cerevisiae) as a bioassay in homeopathic basic research[J]. ScientificWorldJournal, 2011,11:568-583
doi: 10.1100/tsw.2011.45
[16] Tepari R, Stuparevi I, Mrsa V . Increased mortality of Saccharomyces cerevisiae cell wall protein mutants[J]. Microbiology, 2004,150(Pt 10):3145-3150
doi: 10.1099/mic.0.27296-0 pmid: 15470095
[17] Aust SD. Thiobarbituric acid assay reactants. In: Tyson CA, Frazier ZM. Methods in toxicology. Vol 1B: In vitro toxity indicators[M]. New York: Academic Press, 1994: 367-376
[18] Lushchak V, Semchyshyn H, Mandryk S, Lushchak O . Possible role of superoxide dismutases in the yeast Saccharomyces cerevisiae under respiratory conditions[J]. Arch Biochem Biophys, 2005,441(1):35-40
doi: 10.1016/j.abb.2005.06.010
[19] Ellman GL . Tissue sulfhydryl groups.[J]. Arch Biochem Biophys, 1959,82(1):70-77
doi: 10.1016/0003-9861(59)90090-6
[20] Bradford MM . A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding[J]. Anal Biochem, 1976,72:248-254
doi: 10.1016/0003-2697(76)90527-3
[21] Maehly AC, Chance B. Assay of catalases and peroxidases. In: Colowick SP, Kaplan NO. Methods in enzymology. Vol 2: Preparation and assay of enzymes[M]. New York: Academic Press, 1955: 764-774
[22] Nishikimi M, Appaji N, Yagi K . The occurrence of superoxide anion in the reaction of reduced phenazine methosulfate and molecular oxygen[J]. Biochem Biophys Res Commun, 1972,46(2):849-854
doi: 10.1016/S0006-291X(72)80218-3
[23] Miloshev G, Mihaylov I, Anachkova B . Application of the single cell gel electrophoresis on yeast cells[J]. Mutat Res, 2002,513(1-2):69-74
doi: 10.1016/S1383-5718(01)00286-8 pmid: 11719091
[24] Linde K, Jonas WB, Melchart D, Worku F, Wagner H, Eitel F . Critical review and meta-analysis of serial agitated dilutions in experimental toxicology[J]. Hum Exp Toxicol, 1994,13(7):481-492
doi: 10.1177/096032719401300706 pmid: 7917505
[25] Scherr C, Baumgartner S, Spranger J, Simon M . Effects of potentised substances on growth kinetics of Saccharomyces cerevisiae and Schizosaccharomyces pombe[J]. Forsch Komplementmed, 2006,13(5):298-306
[26] Nyström T . Role of oxidative carbonylation in protein quality control and senescence[J]. EMBO J, 2005,24(7):1311-1317
doi: 10.1038/sj.emboj.7600599 pmid: 15775985
[27] Imlay JA, Linn S . DNA damage and oxygen radical toxicity[J]. Science, 1988,240(4857):1302-1309
doi: 10.1126/science.3287616
[28] Panda SK . Advances in stress physiology of plants[M]. Jodhpur: Scientific Publishers, 2002: 1-13
[29] Kuge S, Jones N, Nomoto A . Regulation of yAP-1 nuclear localization in response to oxidative stress[J]. EMBO J, 1997,16(7):1710-1720
doi: 10.1093/emboj/16.7.1710 pmid: 9130715
[30] Lee RE, Puente LG, Kaern M, Megeney LA . A non-death role of the yeast metacaspase: Yca1p alters cell cycle dynamics[J]. PLoS One, 2008,3(8):e2956
doi: 10.1371/journal.pone.0002956 pmid: 18698411
[1] Cai-lian Fana, Wan-jun Caib, Meng-nan Ye, Miao Chen, Yi Dai. Qili Qiangxin, a compound herbal medicine formula, alleviates hypoxia-reoxygenation-induced apoptotic and autophagic cell death via suppression of ROS/AMPK/mTOR pathway in vitro. Journal of Integrative Medicine, 2022, 20(4): 365-375.
[2] Ubiratan Cardinalli Adler, Maristela Schiabel Adler, Ana Elisa Madureira Padula, Livia Mitchiguian Hotta, Amarilysde Toledo Cesar, José Nelson Martins Diniz, Helen de Freitas Santos, Edson Zangiacomi Martinez. Homeopathy for COVID-19 in primary care: A randomized, double-blind, placebo-controlled trial (COVID-Simile study). Journal of Integrative Medicine, 2022, 20(3): 221-229.
[3] Mikhail Teppone. Medicine has always been “Modern” and “Scientific” from ancient times to the present day. Journal of Integrative Medicine, 2019, 17(4): 229-237.
[4] Bruno José Martins Da Silva, Sandro Wilson Gomes Pereira, Ana Paula Drummond Rodrigues, José Luiz Martins Do Nascimento, Edilene Oliveira Silva. In vitro antileishmanial effects of Physalis angulata root extract on Leishmania infantum. Journal of Integrative Medicine, 2018, 16(6): 404-410.
[5] Ubiratan Cardinalli Adler, Ana Carolina Acorinte, Fernando Oliveira Calzavara, Adriano Andréda Silva, Amarilys de Toledo Cesar, Maristela Schiabel Adler, Edson Zangiacomi Martinez, José Carlos Fernandes Galduróz. Double-blind evaluation of homeopathy on cocaine craving: A randomized controlled pilot study. Journal of Integrative Medicine, 2018, 16(3): 178-184.
[6] Shubha Singhal, Vandana Roy. Awareness, practice and views about integrating AYUSH in allopathic curriculum of allopathic doctors and interns in a tertiary care teaching hospital in New Delhi, India. Journal of Integrative Medicine, 2018, 16(2): 113-119.
[7] Salvatore Chirumbolo, Geir Bjørklund. Homeopathic potencies of Arnica montana L. change gene expression in a Tamm-Horsfall protein-1 cell line in vitro model: The role of ethanol as a possible confounder and statistical bias. Journal of Integrative Medicine, 2017, 15(4): 255-264.
[8] Saeed Ahmad, Tayyeba Rehman, Waheed Mumtaz Abbasi. Effects of homoeopathic ultrahigh dilutions of Aconitum napellus on Baker's yeast-induced fever in rabbits. Journal of Integrative Medicine, 2017, 15(3): 209-213.
[9] Roslinah Mohamad Hussain, Noor Faradilla Abdullah, Zulkhairi Amom. Killing of Staphylococcus aureus by allylpyrocatechol is potentiated by induction of intracellular oxidative stress and inhibition of catalase activity. Journal of Integrative Medicine, 2016, 14(6): 456-464.
[10] Yuki Takauji, Kyoko Morino, Kensuke Miki, Mohammad Hossain, Dai Ayusawa, Michihiko Fujii. Chyawanprash, a formulation of traditional Ayurvedic medicine, shows a protective effect on skin photoaging in hairless mice. Journal of Integrative Medicine, 2016, 14(6): 473-479.
[11] Jesmin Mondal, Asmita Samadder, Anisur Rahman Khuda-Bukhsh. Psorinum 6× triggers apoptosis signals in human lung cancer cells. Journal of Integrative Medicine, 2016, 14(2): 143-153.
[12] Santu Kumar Saha, Sourav Roy, Anisur Rahman Khuda-Bukhsh. Ultra-highly diluted plant extracts of Hydrastis canadensis and Marsdenia condurango induce epigenetic modifications and alter gene expression profiles in HeLa cells in vitro. Journal of Integrative Medicine, 2015, 13(6): 400-411.
[13] Subhranil Saha​, Munmun Koley​, Subhasish Ganguly​, Prasanta Rath​, Pulak Roy Chowdhury, Seikh Intaj Hossain. Developing the criteria for evaluating quality of individualization in homeopathic clinical trialreporting: A preliminary study. Journal of Integrative Medicine, 2014, 12(1): 13-19.
[14] Subhranil Saha​, Munmun Koley, Jogendra Singh Arya, Gurudev Choubey, Shubhamoy Ghosh​, Subhasish Ganguly​, Aloke Ghosh​, Sangita Saha​, Malay Mundle​. Medicine prescription practices of homeopathic undergraduate students in West Bengal, India. Journal of Integrative Medicine, 2014, 12(1): 7-12.
[15] Mukherjee Avinaba, Boujedaini Naoual, Rahman Khuda-Bukhsh Anisur. Homeopathic Thuja 30C ameliorates benzo(a)pyrene-induced DNA damage, stress and viability of perfused lung cells of mice in vitro. Journal of Chinese Integrative Medicine, 2013, 11(6): 397-404.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
[1] Jin-zhou Tian, Jing Shi, Xin-qing Zhang, Qi Bi, Xin Ma, Zhi-liang Wang, Xiao-bin Li, Shu-li Shen, Lin Li, Zhen-yun Wu, Li-yan Fang, Xiao-dong Zhao, Ying-chun Miao, Peng-wen Wang, Ying Ren, Jun-xiang Yin, Yong-yan Wang, Beijing United Study Group on MCI of the Capital Foundation of Medical Developments. An explanation on "guiding principles of clinical research on mild cognitive impairment (protocol)". Journal of Chinese Integrative Medicine, 2008, 6(1): 15-21
[2] Yi-ting He, Qing-lin Zha, Jian-ping Yu, Yong Tan, Cheng Lu, Ai-ping Lv. Principal factor analysis of symptoms of rheumatoid arthritis and their correlations with efficacy of traditional Chinese medicine and Western medicine. Journal of Chinese Integrative Medicine, 2008, 6(1): 32-36
[3] Jun Cai, Hua Wang, Sheng Zhou, Bin Wu, Hua-rong Song, Zheng-rong Xuan. Effect of Sijunzi Decoction and enteral nutrition on T-cell subsets and nutritional status in patients with gastric cancer after operation: A randomized controlled trial. Journal of Chinese Integrative Medicine, 2008, 6(1): 37-40
[4] Wei Zhang, Xiang-feng Lu, Xiao-mei Zhang, Jian-jun Wu, Liang-duo Jiang. A rat model of pulmonary fibrosis induced by infusing bleomycin quickly through tracheal intubation. Journal of Chinese Integrative Medicine, 2008, 6(1): 60-67
[5] A-gao Zhou, Yong Zhang, Gang Kui, De-Yun Kong, Hai-liang Ge, Qiu-hua Ren, Jia-rong Dong, Sheng Hong, Xu-ming Mao, Yin Wang, Hui-zheng Zhang, Shu-jun Wang. Influence of traditional Chinese compound recipes with different efficacy on body weight, tumor weight and immune function in H22 cancer-bearing mice. Journal of Chinese Integrative Medicine, 2008, 6(1): 77-82
[6] Guo-hong Yuan, Xiao-jing Pang, He-chao Ma. Synergic effects of Danggui Buxue Decoction in reducing toxicity of cytoxan in tumor-bearing mice. Journal of Chinese Integrative Medicine, 2008, 6(1): 83-88
[7] Li Zhou, Hong-xing Zhang, Ling-guang Liu, Wen-jun Wan. Effect of electro-acupuncture at Fenglong (GV 16) on nitric oxide and endothelin in rats with hyperlipidemia. Journal of Chinese Integrative Medicine, 2008, 6(1): 89-92
[8] Jin-zhou Tian, Jing Shi, Xin-qing Zhang, Qi Bi, Xin Ma, Zhi-liang Wang, Xiao-bin Li, Shu-li Shen, Lin Li, Zhen-yun Wu, Li-yan Fang, Xiao-dong Zhao, Ying-chun Miao, Peng-wen Wang, Ying Ren, Jun-xiang Yin, Yong-yan Wang, Beijing United Study Group on MCI of the Capital Foundation of Medical Developments. Guiding principles of clinical research on mild cognitive impairment (protocol). Journal of Chinese Integrative Medicine, 2008, 6(1): 9-14
[9] Xin-jun Wang, Ling-ling Wang . A mechanism of endogenous opioid peptides for rapid onset of acupuncture effect in treatment of depression. Journal of Chinese Integrative Medicine, 2010, 8(11): 1014-1017
[10] Bo Wang , Wei Yan , Li-hui Hou, Xiao-ke Wu. Disorder of Tiangui (kidney essence) and reproductive dysfunction in patients with polycystic ovary syndrome. Journal of Chinese Integrative Medicine, 2010, 8(11): 1018-1022
Journal of Integrative Medicine, ISSN: 2095-4964 CN 31-2083/R
Copyright © Journal of Integrative Medicine
Powered by Beijing Magtech Co. Ltd
沪公网安备31010602003416号      沪ICP备18017633号-3