[an error occurred while processing this directive]

Journal of Chinese Integrative Medicine ›› 2006, Vol. 4 ›› Issue (3): 303-306.doi: 10.3736/jcim20060317

• Original Experimental Research • Previous Articles     Next Articles

Effects of soybean isoflavones on expression levels of osteoprotegerin and osteoprotegerin ligand mRNAs in bone tissues of ovariectomized rats

Qiang Wang1, Kun-zheng Wang1, Guang-ye Wang2   

  1. 1. Department of Orthopaedics, Second Hospital of Xi’an Jiaotong University, Xian, Shaanxi Province 710004, China;
    2. Depar tment of Orthopaedics , Changhai Hospital, Second Military Medical University , Shanghai 200433 , China
  • Online:2006-05-31 Published:2006-05-15

RichHTML

0

PDF (PC)

149

Like

Objective

To investigate the effects of soybean isoflavones (SI) on expression levels of osteoprotegerin (OPG) and osteoprotegerin ligand (OPGL) mRNAs in bone tissues of ovariectomized rats, and to discuss the mechanism of soybean isoflavaones in preventing and treating postmenopausal osteoporosis (PMO).

Methods

Thirty adult SD rats were randomly divided into 3 groups: sham-operation group, untreated group and SI-treated group. The rats in the last two groups were bilaterally ovariectomized. The bone density of L3 to L6 vertebrae was detected after 12-week intervention. Total RNA was extracted from femur head and the expression levels of OPG and OPGL mRNAs were examined by real-time quantitative polymerase chain reaction.

Results

SI could increase the bone density of lumbar vertebrae in ovariectomized rats, up-regulate the expression level of OPG mRNA and down-regulate the ratio of OPGL mRNA/OPG mRNA, but exert no significant effect on the expression of OPGL mRNA.

Conclusion

The therapeutic effects of SI on PMO may be related to regulating the expression levels of OPG and OPGL mRNAs, and the ratio of OPGL mRNA/OPG mRNA.

Key words: Soybean isoflavones, Osteoporosis, Postmenopausal, Cytokines, Bone density

CLC Number: 

  • R681.4

Table 1

Primers for RTQ-PCR"

Target gene Forward primer Reverse primer Amplified fragment length Genbank number
GAPDH TGAACGGGAAGCTCACTGG TCCACCACCCTGTTGCTGTA 307 NM_008084
OPG CATCGAAAGCACCCTGTA CACTCAGCCAATTCGGTAT 201 NM_012870
OPGL CGTACCTGCGGACTATCTTCA GTTGGACACCTGGACGCTAA 196 AF187319

Figure 1

Histological changes of femur head of left side in rats after 12-week intervention in the sham-operation（A）, untreated（B） and SI-treated （C） groups (HE staining, phase-contrast microscope, 10×10)"

Table 2

Changes of bone density of L3-L6 vertebraein rats in three groups (ヌ±S)"

Group n Bone density
Sham-operation 10 0.335±0.006*△
Untreated 10 0.304±0.006△
SI-treated 10 0.315±0.017*

Table 3

Expression levels of OPG mRNA, OPGL mRNA and OPGL mRNA/OPG mRNA ratio in bone tissues of rats in three groups (ヌ±S)"

Group n OPG mRNA OPGL mRNA OPGL mRNA/OPG mRNA
Sham-operation 10 1.000±0.35*△ 1.000±0.69*△ 1.000±0.32*
Untreated 10 0.119±0.04△ 6.162±4.70 47.796±21.88△
SI-treated 10 0.695±0.40* 4.591±3.23 6.566±2.22*
[1] 杜宁, 许勇 . 异黄酮的医用价值[J]. 中西医结合学报, 2003,1(4):296-300
[2] Harkness LS, Fiedler K, Sehgal AR , et al. Decreased bone resorption with soy isoflavone supplementation in postmenopausal women[J]. J Womens Health, 2004,13(9):1000-1007
doi: 10.1089/jwh.2004.13.1000 pmid: 15665657
[3] Giulietti A, Overbergh L, Valckx D , et al. An Overview of real-time quantitative PCR: Applications to quantify cytokine gene expression[J]. Methods, 2001,25(4):386-401
doi: 10.1006/meth.2001.1261 pmid: 11846608
[4] Hofbauer LC, Khosla S, Dunstan CR , et al. The roles of osteoprotegerin and osteoprotegerin ligand in the paracrine regulation of bone resorption[J]. J Bone Miner Res, 2000,15(1):2-12
[5] Yamagishi T, Otsuka E, Hagiwara H . Reciprocal control of expression of mRNAs for osteoclast differentiation factor and OPG in osteogenic stromal cells by genistein: Evidence for the involvement of topoisomerase Ⅱ in osteoclastogenesis[J]. Endocrinology, 2001,142(8):3632-3637
[6] Kong YY, Yoshida H , I Sarosi I , et al.OPGL is a key regulator of osteoclastogenesis, lymphocyte development and lymph-node organogenesis[J]. Nature, 1999,397(6717):315-323
[7] Saika M, Inoue D, Kido S , et al. 17 beta-estradiol stimulates expression of osteoprotegerin by a mouse stromal cell line, ST-2, via estrogen receptor-alpha[J]. Endocrinology, 2001,142(6):2205-2212
[8] Fazzalari NL, Kuliwaba JS, Atkins GJ , et al. The ratio of messenger RNA levels of receptor activator of nuclear factor kappaB ligand to osteoprotegerin correlates with bone emodeling indices in normal human cancellous bone but not in osteoarthritis[J]. J Bone Miner Res, 2001,16(6):1015-1027
[1] Lei Liu, Yuan-hui Guo , Hai-liang Xin , Yan Nie , Ting Han, Lu-ping Qin , Oiao-yan Zhang. Antiosteoporotic effects of benzylbenzoate glucosides from Curculigo orchioides in ovariectomized rats. Journal of Chinese Integrative Medicine, 2012, 10(12): 1419-1426.
[2] Gui-lin Ouyang, Xiao-hui Feng, Lian-bo Xiao, Zheng Huang, Qing Xia, Da-peng Han, Fei Zhu . Effects of Chinese herbal medicine Qianggu Capsule on patients with rheumatoid arthritis-induced osteoporosis: a report of 82 cases. Journal of Chinese Integrative Medicine, 2012, 10(12): 1394-1399.
[3] Xiang-ying Mao , Qin Bian , Zi-yin Shen. Analysis of the osteogenetic effects exerted on mesenchymal stem cell strain C3H10T1/2 by icariin via MAPK signaling pathway in vitro. Journal of Chinese Integrative Medicine, 2012, 10(11): 1272-1278.
[4] Dong-tao Li, Jian Wang , Hong-yang Jiang , Feng-lei Shi , Fu-yu Li , Ji-hong Liu , Yong-mei Cheng , Nan Yan , Ai-hua Hu, Mei-zeng Zhang , Jie Li, Ling-bo Wei , Rong-qin Jiang. Quantitative evaluation of the degrees of traditional Chinese medicine qualitative syndromes of osteoporosis. Journal of Chinese Integrative Medicine, 2012, 10(11): 1254-1262.
[5] Lei Bao, Shi-en Zou, Shao-fen Zhang. Dose-dependent effects of daidzein in regulating bone formation through estrogen receptors and peroxisome proliferator-activated receptor γ. Journal of Chinese Integrative Medicine, 2011, 9(2): 165-172.
[6] Zhi-ming Huang, Gui-ling Ouyang, Lian-bao Xiao, Ning-li Li, Hua-li Gao, Yong He, Zheng Huang, Xin-xing Huang. Effects of Drynaria total flavonoids on apoptosis of osteoblasts mediated by tumor necrosis factor-α. Journal of Chinese Integrative Medicine, 2011, 9(2): 173-178.
[7] Li Dong-tao, Li Fu-yu, Wang Jian, Liu Ji-hong, Yan Nan, Cheng Yong-mei, Hu Ai-hua, Jiang Hong-yang, Shi Feng-lei, Zhang Mei-zeng, Li Jie, Wei Ling-bo, Jiang Rong-qin. A study of diagnostic criteria for traditional Chinese medicine syndromes in osteoporosis. Journal of Chinese Integrative Medicine, 2011, 9(12): 1326-1332.
[8] Praveen Srikanta, Shivaprasad H. Nagarajappa, Gollapalle L. Viswanatha, Mukund Handral, Rajesh Subbanna, Rangappa Srinath, Ganesh Hiremath. Anti-osteoporotic activity of methanolic extract of an Indian herbal formula NR/CAL/06 in ovariectomized rats. Journal of Chinese Integrative Medicine, 2011, 9(10): 1125-1132.
[9] Wen Sun, Jian Yu, Yu-min Shi, Hao Zhang, Ying Wang, Bing-bing Wu. Effects of Cordyceps extract on cytokines and transcription factors in peripheral blood mononuclear cells of asthmatic children during remission stage. Journal of Chinese Integrative Medicine, 2010, 8(4): 341-346.
[10] Xin-xiang Wang , Yun-ling Zhang, Qi-fu Huang. Discussion on the main pathogenesis in traditional Chinese medicine and etiology about primary osteoporosis. Journal of Chinese Integrative Medicine, 2010, 8(12): 1119-1123.
[11] Daniel Weber, Janelle M Wheat, Geoffrey M Currie. Inflammation and cancer: Tumor initiation, progression and metastasis,and Chinese botanical medicines. Journal of Chinese Integrative Medicine, 2010, 8(11): 1006-1013.
[12] Ju-yong Wang, Zhan Zheng, Zhen-ye Xu, Jing Guo, Wan So. Effects of Feiyanning Decoction on proliferation of lung adenocarcinoma cell line and their production of interleukin-6 and interleukin-8 induced by tumor necrosis factor-α. Journal of Chinese Integrative Medicine, 2009, 7(8): 741-745.
[13] Yi Xin, Tian-fang Wang, Cai-feng Du, Li Li, Jie Ren, Zhe Jin, Hong Zhao, Xiao-juan Zou , Hong-qi Liu, Ying Chen, Li-na Wang, Rui-fen Liu, Qing-guo Wang. Distribution characteristics of common syndrome types and syndrome elements extracted by experts' experience in perimenopausal and postmenopausal women. Journal of Chinese Integrative Medicine, 2009, 7(6): 522-526.
[14] WEI Peng, JIAO Lei, QIN Lu-ping, YAN Fei, HAN Ting, ZHANG Qiao-yan. Effects of berberine on differentiation and bone resorption of osteoclasts derived from rat bone marrow cells. Journal of Chinese Integrative Medicine, 2009, 7(4): 342-348.
[15] Wei Zhang, Jing-tao Cao, Hai-yu Liu. Effects of pathogenic wind-dampness on lung tissue cytokines in rats with syndrome due to pathogenic cold invading lung. Journal of Chinese Integrative Medicine, 2008, 6(7): 748-751.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
[1] Jin-rong Fu. Establishment of multivariate diagnosis and treatment system of modern gynecology of traditional Chinese medicine. Journal of Chinese Integrative Medicine, 2008, 6(1): 22-24
[2] Hao Li, Ming-jiang Yao, Wen-ming Zhao, Jie Guan, Lin-lin Cai, Ling Cui. A randomized, controlled, double-blind trial of Huannao Yicong capsule in senile patients with mild cognitive impairment. Journal of Chinese Integrative Medicine, 2008, 6(1): 25-31
[3] Zhi-chun Jin. Problems in establishing clinical guideline for integrated traditional Chinese and Western medicine. Journal of Chinese Integrative Medicine, 2008, 6(1): 5-8
[4] SUN Ming-yu, ZUO Jian, DUAN Ji-feng, HAN Jun, FAN Shi-ming, ZHANG Wei, ZHU Li-fang, YAO Ming-hui. Antitumor activities of kushen flavonoids in vivo and in vitro. Journal of Chinese Integrative Medicine, 2008, 6(1): 51-59
[5] Min Cheng, Qiong Feng, Shu-wen Qian, Hui Gao, Cui-qing Zhu. Preliminary assay of p-amyloid binding elements in heart-beneficial recipe. Journal of Chinese Integrative Medicine, 2008, 6(1): 68-72
[6] Ning-qun Wang, Liang-duo Jiang, Zong-xing Li. Research progress in asthma-related quality of life. Journal of Chinese Integrative Medicine, 2008, 6(1): 93-97
[7] Jing-yuan Mao, Chang-xiao Liu, Heng-he Wang, Guang-li Wei , Zhen-peng Zhang, Jie Xing, Wang Xian liang , Ying-fei Bi . Effects of Shenmai Injection on serum concentration and pharmacokinetics of digoxin in dogs with heart failure. Journal of Chinese Integrative Medicine, 2010, 8(11): 1070-1074
[8] Zhi-mei Wang, Bin Zhang. A study on translation of ellipses in Huangdi Neijing from perspective of hermeneutic theory. Journal of Chinese Integrative Medicine, 2010, 8(11): 1097-1100
[9] Gui Yu, Jie Wang. Thinking on building the network cardiovasology of Chinese medicine. Journal of Chinese Integrative Medicine, 2012, 10(11): 1206-1210
[10] Pedro Saganha João, Doenitz Christoph, Greten Tobias, Efferth Thomas, J. Greten Henry. Qigong therapy for physiotherapists suffering from burnout: a preliminary study. Journal of Chinese Integrative Medicine, 2012, 10(11): 1233-1239
[an error occurred while processing this directive]