SUBSCRIBE
Search JIM Advanced Search

Journal of Chinese Integrative Medicine ›› 2006, Vol. 4 ›› Issue (3): 303-306.doi: 10.3736/jcim20060317

• Original Experimental Research • Previous Articles     Next Articles

Effects of soybean isoflavones on expression levels of osteoprotegerin and osteoprotegerin ligand mRNAs in bone tissues of ovariectomized rats

Qiang Wang1, Kun-zheng Wang1, Guang-ye Wang2   

  1. 1. Department of Orthopaedics, Second Hospital of Xi’an Jiaotong University, Xian, Shaanxi Province 710004, China;
    2. Depar tment of Orthopaedics , Changhai Hospital, Second Military Medical University , Shanghai 200433 , China
  • Online:2006-05-31 Published:2006-05-15

RichHTML

0

PDF (PC)

67

Like

Objective

To investigate the effects of soybean isoflavones (SI) on expression levels of osteoprotegerin (OPG) and osteoprotegerin ligand (OPGL) mRNAs in bone tissues of ovariectomized rats, and to discuss the mechanism of soybean isoflavaones in preventing and treating postmenopausal osteoporosis (PMO).

Methods

Thirty adult SD rats were randomly divided into 3 groups: sham-operation group, untreated group and SI-treated group. The rats in the last two groups were bilaterally ovariectomized. The bone density of L3 to L6 vertebrae was detected after 12-week intervention. Total RNA was extracted from femur head and the expression levels of OPG and OPGL mRNAs were examined by real-time quantitative polymerase chain reaction.

Results

SI could increase the bone density of lumbar vertebrae in ovariectomized rats, up-regulate the expression level of OPG mRNA and down-regulate the ratio of OPGL mRNA/OPG mRNA, but exert no significant effect on the expression of OPGL mRNA.

Conclusion

The therapeutic effects of SI on PMO may be related to regulating the expression levels of OPG and OPGL mRNAs, and the ratio of OPGL mRNA/OPG mRNA.

Key words: Soybean isoflavones, Osteoporosis, Postmenopausal, Cytokines, Bone density

CLC Number: 

  • R681.4

Table 1

Primers for RTQ-PCR"

Target gene Forward primer Reverse primer Amplified fragment length Genbank number
GAPDH TGAACGGGAAGCTCACTGG TCCACCACCCTGTTGCTGTA 307 NM_008084
OPG CATCGAAAGCACCCTGTA CACTCAGCCAATTCGGTAT 201 NM_012870
OPGL CGTACCTGCGGACTATCTTCA GTTGGACACCTGGACGCTAA 196 AF187319

Figure 1

Histological changes of femur head of left side in rats after 12-week intervention in the sham-operation（A）, untreated（B） and SI-treated （C） groups (HE staining, phase-contrast microscope, 10×10)"

Table 2

Changes of bone density of L3-L6 vertebraein rats in three groups (ヌ±S)"

Group n Bone density
Sham-operation 10 0.335±0.006*△
Untreated 10 0.304±0.006△
SI-treated 10 0.315±0.017*

Table 3

Expression levels of OPG mRNA, OPGL mRNA and OPGL mRNA/OPG mRNA ratio in bone tissues of rats in three groups (ヌ±S)"

Group n OPG mRNA OPGL mRNA OPGL mRNA/OPG mRNA
Sham-operation 10 1.000±0.35*△ 1.000±0.69*△ 1.000±0.32*
Untreated 10 0.119±0.04△ 6.162±4.70 47.796±21.88△
SI-treated 10 0.695±0.40* 4.591±3.23 6.566±2.22*
[1] 杜宁, 许勇 . 异黄酮的医用价值[J]. 中西医结合学报, 2003,1(4):296-300
[2] Harkness LS, Fiedler K, Sehgal AR , et al. Decreased bone resorption with soy isoflavone supplementation in postmenopausal women[J]. J Womens Health, 2004,13(9):1000-1007
doi: 10.1089/jwh.2004.13.1000 pmid: 15665657
[3] Giulietti A, Overbergh L, Valckx D , et al. An Overview of real-time quantitative PCR: Applications to quantify cytokine gene expression[J]. Methods, 2001,25(4):386-401
doi: 10.1006/meth.2001.1261 pmid: 11846608
[4] Hofbauer LC, Khosla S, Dunstan CR , et al. The roles of osteoprotegerin and osteoprotegerin ligand in the paracrine regulation of bone resorption[J]. J Bone Miner Res, 2000,15(1):2-12
[5] Yamagishi T, Otsuka E, Hagiwara H . Reciprocal control of expression of mRNAs for osteoclast differentiation factor and OPG in osteogenic stromal cells by genistein: Evidence for the involvement of topoisomerase Ⅱ in osteoclastogenesis[J]. Endocrinology, 2001,142(8):3632-3637
[6] Kong YY, Yoshida H , I Sarosi I , et al.OPGL is a key regulator of osteoclastogenesis, lymphocyte development and lymph-node organogenesis[J]. Nature, 1999,397(6717):315-323
[7] Saika M, Inoue D, Kido S , et al. 17 beta-estradiol stimulates expression of osteoprotegerin by a mouse stromal cell line, ST-2, via estrogen receptor-alpha[J]. Endocrinology, 2001,142(6):2205-2212
[8] Fazzalari NL, Kuliwaba JS, Atkins GJ , et al. The ratio of messenger RNA levels of receptor activator of nuclear factor kappaB ligand to osteoprotegerin correlates with bone emodeling indices in normal human cancellous bone but not in osteoarthritis[J]. J Bone Miner Res, 2001,16(6):1015-1027
[1] Ye-juan Jia, Tian-yu Li, Peng Han, Yu Chen, Li-jia Pan, Chun-sheng Jia. Effects of different courses of moxibustion treatment on intestinal flora and inflammation of a rat model of knee osteoarthritis. Journal of Integrative Medicine, 2022, 20(2): 173-181.
[2] Joon-ho Lee, Yuan-ji Wei, Zhong-yan Zhou, Yu-ming Hou, Cheng-long Wang, Li-bo Wang, Hong-jin Wu, Yu Zhang, Wei-wei Dai. Efficacy of the herbal pair, Radix Achyranthis Bidentatae and Eucommiae Cortex, in preventing glucocorticoid-induced osteoporosis in the zebrafish model. Journal of Integrative Medicine, 2022, 20(1): 83-90.
[3] Hui Chen, Wei Feng, Ye Lu, Yi Yang, Zhong-hai Xin, Man Li, Li Xin, Ying-di Gong. Effects and mechanism of Chinese medicine Jiawei Yupingfeng in a mouse model of allergic rhinitis. Journal of Integrative Medicine, 2021, 19(4): 354-361.
[4] Pádraic J.Dunne, Julie Lynch, Lucia Prihodova, Caoimhe O'Leary, Atiyeh Ghoreyshi, Sharee A. Basdeo, Donal J.Cox, Rachel Breen, Ali Sheikhi, Áine Carroll, Cathal Walsh, Geraldine McMahon, Barry White. Burnout in the emergency department: Randomized controlled trial of an attention-based training program. Journal of Integrative Medicine, 2019, 17(3): 173-180.
[5] Syed Nasir Abbas Bukhari, Fahad Hussain, Hnin Ei Thu, Zahid Hussain. Synergistic effects of combined therapy of curcumin and Fructus Ligustri Lucidi for treatment of osteoporosis: cellular and molecular evidence of enhanced bone formation. Journal of Integrative Medicine, 2019, 17(1): 38-45.
[6] J.M. Oliver-Baxter, H.S. Whitford, D.A. Turnbull, M.J. Bond. Effects of vitamin supplementation on inflammatory markers and psychological wellbeing among distressed women: A randomized controlled trial. Journal of Integrative Medicine, 2018, 16(5): 322-328.
[7] Uday P. Pratap, Hannah P. Priyanka, Karthik R. Ramanathan, Vishak Raman, Lalgi Hima, Srinivasan Thyagarajan. Noni (Morinda citrifolia L.) fruit juice delays immunosenescence in the lymphocytes in lymph nodes of old F344 rats. Journal of Integrative Medicine, 2018, 16(3): 199-207.
[8] Lilian Uchoa Carneiro, Ilna Gomes da Silva, Mirian Eliza Alves de Souza, Wellington da Silva Côrtes, Mário Geraldo de Carvalho, Bruno Guimarães Marinho. Antinociceptive and anti-inflammatory activities of leaf extracts from Annona tomentosa R.E.Fr. Journal of Integrative Medicine, 2017, 15(5): 379-387.
[9] Shi-li Jiang, Xu-dong Hu, Ping Liu. Immunomodulation and liver protection of Yinchenhao decoction against concanavalin A-induced chronic liver injury in mice. Journal of Integrative Medicine, 2015, 13(4): 262-268.
[10] Urmila Aswar, Mayuri Gurav, Ganesh More, Khaled Rashed, Manoj Aswar. Effect of aqueous extract of Solanum xanthocarpum Schrad. & Wendl. on postmenopausal syndrome in ovariectomized rats. Journal of Integrative Medicine, 2014, 12(5): 439-446.
[11] Lei Liu, Yuan-hui Guo , Hai-liang Xin , Yan Nie , Ting Han, Lu-ping Qin , Oiao-yan Zhang. Antiosteoporotic effects of benzylbenzoate glucosides from Curculigo orchioides in ovariectomized rats. Journal of Chinese Integrative Medicine, 2012, 10(12): 1419-1426.
[12] Gui-lin Ouyang, Xiao-hui Feng, Lian-bo Xiao, Zheng Huang, Qing Xia, Da-peng Han, Fei Zhu . Effects of Chinese herbal medicine Qianggu Capsule on patients with rheumatoid arthritis-induced osteoporosis: a report of 82 cases. Journal of Chinese Integrative Medicine, 2012, 10(12): 1394-1399.
[13] Xiang-ying Mao , Qin Bian , Zi-yin Shen. Analysis of the osteogenetic effects exerted on mesenchymal stem cell strain C3H10T1/2 by icariin via MAPK signaling pathway in vitro. Journal of Chinese Integrative Medicine, 2012, 10(11): 1272-1278.
[14] Dong-tao Li, Jian Wang , Hong-yang Jiang , Feng-lei Shi , Fu-yu Li , Ji-hong Liu , Yong-mei Cheng , Nan Yan , Ai-hua Hu, Mei-zeng Zhang , Jie Li, Ling-bo Wei , Rong-qin Jiang. Quantitative evaluation of the degrees of traditional Chinese medicine qualitative syndromes of osteoporosis. Journal of Chinese Integrative Medicine, 2012, 10(11): 1254-1262.
[15] Lei Bao, Shi-en Zou, Shao-fen Zhang. Dose-dependent effects of daidzein in regulating bone formation through estrogen receptors and peroxisome proliferator-activated receptor γ. Journal of Chinese Integrative Medicine, 2011, 9(2): 165-172.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
[1] Jin-rong Fu. Establishment of multivariate diagnosis and treatment system of modern gynecology of traditional Chinese medicine. Journal of Chinese Integrative Medicine, 2008, 6(1): 22-24
[2] Hao Li, Ming-jiang Yao, Wen-ming Zhao, Jie Guan, Lin-lin Cai, Ling Cui. A randomized, controlled, double-blind trial of Huannao Yicong capsule in senile patients with mild cognitive impairment. Journal of Chinese Integrative Medicine, 2008, 6(1): 25-31
[3] Zhi-chun Jin. Problems in establishing clinical guideline for integrated traditional Chinese and Western medicine. Journal of Chinese Integrative Medicine, 2008, 6(1): 5-8
[4] SUN Ming-yu, ZUO Jian, DUAN Ji-feng, HAN Jun, FAN Shi-ming, ZHANG Wei, ZHU Li-fang, YAO Ming-hui. Antitumor activities of kushen flavonoids in vivo and in vitro. Journal of Chinese Integrative Medicine, 2008, 6(1): 51-59
[5] Min Cheng, Qiong Feng, Shu-wen Qian, Hui Gao, Cui-qing Zhu. Preliminary assay of p-amyloid binding elements in heart-beneficial recipe. Journal of Chinese Integrative Medicine, 2008, 6(1): 68-72
[6] Ning-qun Wang, Liang-duo Jiang, Zong-xing Li. Research progress in asthma-related quality of life. Journal of Chinese Integrative Medicine, 2008, 6(1): 93-97
[7] Jing-yuan Mao, Chang-xiao Liu, Heng-he Wang, Guang-li Wei , Zhen-peng Zhang, Jie Xing, Wang Xian liang , Ying-fei Bi . Effects of Shenmai Injection on serum concentration and pharmacokinetics of digoxin in dogs with heart failure. Journal of Chinese Integrative Medicine, 2010, 8(11): 1070-1074
[8] Zhi-mei Wang, Bin Zhang. A study on translation of ellipses in Huangdi Neijing from perspective of hermeneutic theory. Journal of Chinese Integrative Medicine, 2010, 8(11): 1097-1100
[9] Gui Yu, Jie Wang. Thinking on building the network cardiovasology of Chinese medicine. Journal of Chinese Integrative Medicine, 2012, 10(11): 1206-1210
[10] Pedro Saganha João, Doenitz Christoph, Greten Tobias, Efferth Thomas, J. Greten Henry. Qigong therapy for physiotherapists suffering from burnout: a preliminary study. Journal of Chinese Integrative Medicine, 2012, 10(11): 1233-1239
Journal of Integrative Medicine, ISSN: 2095-4964 CN 31-2083/R
Copyright © Journal of Integrative Medicine
Powered by Beijing Magtech Co. Ltd
沪公网安备31010602003416号      沪ICP备18017633号-3