SUBSCRIBE
Search JIM Advanced Search

Journal of Chinese Integrative Medicine ›› 2007, Vol. 5 ›› Issue (5): 564-569.doi: 10.3736/jcim20070518

• Original Experimental Research • Previous Articles     Next Articles

Protection of Tianshen Yizhi Recipe against low expression of nicotinic receptor and neurotoxicity induced by β-amyloid peptide

GU Ran1,LIU Ru-yu2,ZHANG Lan-jiang1,HAO Xiao-yan3,XIAO Yan1,QI Xiao-lan1,SHAN Ke-ren1,lin REN Xi1,LUO Jun4,GUAN Zhi-zhong1,2   

  1. 1. Department of Molecular Biology ,Guiyang Medical College ,Guiyang ,Guizhou Province 550004,China
    2. Department of Pathology ,Guiyang Medical College ,Guiyang ,Guizhou Province 550004,China
    3. School of Pharmacy ,Guiyang Medical College ,Guiyang ,Guizhou Province 550004,China
    4. School of Preclinical Medicine ,Guiyang Medical College ,Guiyang ,Guizhou Province 550004,China
  • Online:2007-09-20 Published:2018-10-25

RichHTML

PDF (PC)

103

Like

Objective: To investigate the inhibition effects of Tianshen Yizhi Recipe (TSYZR), a compound traditional Chinese herbal medicine, on decreased expression of nicotinic acetylcholine receptor (nAChR) and the neurotoxicity as well as lipid peroxidation induced by beta-amyloid peptide (Aβ) in human SH-SY5Y neuroblastoma cells.Methods: The SH-SY5Y cells were treated by a certain concentration of TSYZR, and then exposed to Aβ25-35. Methyl thiazolyl tetrazolium reduction assay was carried out to understand the influences of the drugs on cellular viability. Expressions of nAChR subunits (α3 and α7) at protein and mRNA levels were detected by Western-blotting and reverse transcription polymerase chain reaction, respectively. Lipid peroxidation was measured by thiobarbituric acid to observe the capacity of antioxidant of the drugs. Results: TSYZR at a safe concentration could increase α7 protein in the cells, inhibit decreased expressions of α3 and α7 nAChR subunit proteins, prevent lower expression of α7 mRNA in SH-SY5Y cells induced by Aβ, reduce the neurotoxicity and lipid peroxidation resulting from Aβ, but had no significant effect on the lower expression of α3 mRNA.Conclusions: TSYZR can up-regulate the expression of α7 nAChR subunit protein and prevent decreased expressions of nAChRs and neurotoxicity as well as lipid peroxidation induced by Aβ. This drug may play an important therapeutic role in treatment of Alzheimer disease.

Key words: neuroblastoma, nicotine, acetylcholine receptors, beta-amyloid pepitide, Alzheimer disease

CLC Number: 

  • R745.1

Table 1

The primer sequences for RT-PCR"

Target gene Primer sequence (5′ to 3′) Fragment size
nAChR α3 forward: TTCAGCCGTGCAGACTCCA 271 bp
reverse: GGCAACGTACTTCCAATCATC
nAChR α7 forward: CGCCACATTCCACACTAAC 257 bp
reverse: ACCTTTCACTCCTCTTGCC
β-actin forward: GCCTGCGCCTGCGGCGACGCC 270 bp
reverse: CCTCACTCACGCTCTGGTCAT
Cyc forward: AGAAAATTTTCGTGCTCTGAGCA 414 bp
reverse: AACACAAGTCAAACTTTATTCGAG

Figure 1

MTT reduction of SH-SY5Y cells treated with different concentrations of Tianshen Yizhi Recipen=6; *P<0.05, **P<0.01, vs normal control group."

Figure 2

MTT reduction of SH-SY5Y cells treated with different drugsCon: Normal control group; Aβ: Aβ-treated group; VE: VE-treated group; VE+Aβ: VE and Aβ treated group; X: TSYZR-treated group; X+Aβ: TSYZR and Aβ treated group. n=6; *P<0.05, **P<0.01, vs normal control group; △△P<0.01, vs Aβ-treated group."

Figure 3

Levels of nAChR α7 subunit protein in SH-SY5Y cells treated with different drugsCon: Normal control group; Aβ: Aβ-treated group; VE: VE-treated group; VE+Aβ: VE and Aβ treated group; X: TSYZR-treated group, X+Aβ: TSYZR and Aβ treated group. n=6; *P<0.05, **P<0.01, vs normal control group; △△P<0.01, vs Aβ-treated group; ▲P<0.05, vs VE and Aβ treated group."

Figure 4

Levels of nAChR α3 subunit protein in SH-SY5Y cells treated with different drugsCon: Normal control group; Aβ: Aβ-treated group; VE: VE-treated group; VE+Aβ: VE and Aβ treated group; X: TSYZR-treated group; X+Aβ: TSYZR and Aβ treated group. n=6; *P<0.05, **P<0.01, vs normal control group; △P<0.05, vs Aβ-treated group."

Figure 5

Levels of nAChR α7 subunit mRNA in SH-SY5Y cells treated with different drugsCon: Normal control group; Aβ: Aβ-treated group; VE: VE-treated group; VE+Aβ: VE and Aβ treated group; X: TSYZR-treated group, X+Aβ: TSYZR and Aβ treated group. n=6; *P<0.05, **P<0.01, vs normal control group; △△P<0.01, vs Aβ-treated group."

Figure 6

Levels of nAChR α3 subunit mRNA in SH-SY5Y cells treated with different drugsCon: Normal control group; Aβ: Aβ-treated group; VE: VE-treated group; VE+Aβ: VE and Aβ treated group; X: TSYZR-treated group, X+Aβ: TSYZR and Aβ treated group. n=6; *P<0.05, **P<0.01, vs normal control group; △△P<0.01, vs Aβ-treated group; ▲P<0.05, vs VE and Aβ treated group."

Table 2

MDA assayed by TBA (ヌ±S , mmol/L)"

Group n MDA
Normal control 6 4.19±0.44
Aβ-treated 6 5.82±0.70**
VE-treated 6 4.16±0.46
VE and Aβ treated 6 4.38±0.43△△
TSYZR-treated 6 4.26±0.29
TSYZR and Aβ treated 6 4.93±0.46*△▲
[1] Dajas-Bailador F, Wonnacott S . Nicotinic acetylcholine receptors and the regulation of neuronal signaling[J]. Trends Pharmacol Sci, 2004,25(6):317-324
doi: 10.1016/j.tips.2004.04.006 pmid: 15165747
[2] Nordberg A . Nicotinic receptor abnormalities of Alzheimer's disease: therapeutic implications[J]. Biol Psychiatry, 2001,49(3):200-210
[3] Liu Y, Peterson DA, Kimura H , et al. Mechanism of cellular 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide(MTT) reduction[J]. J Neurochem, 1997,69(2):581-593
[4] Guan ZZ, Miao H, Tian JY , et al. Suppressed expression of nicotinic acetylcholine receptors by nanomolar beta-amyloid peptides in PC12 cells[J]. J Neural Transm, 2001,108(12):1417-1433
doi: 10.1007/s007020100017
Guan ZZ, Miao H, Tian JY , et al. Suppressed expression of nicotinic acetylcholine receptors by nanomolar beta-amyloid peptides in PC12 cells[J]. J Neural Transm, 2001,108(2):1417-1433
[5] Guan ZZ, Zhang X, Mousavi M , et al. Reduced expression of neuronal nicotinic acetylcholine receptors during the early stages of damage by oxidative stress in PC12 cells[J]. J Neurosci Res, 2001,66(4):551-558
[6] Nordberg A, Lundqkvist H, Hartvig P , et al. Imaging of nicotinic and muscarinic receptors in Alzheimer's disease: effect of tacrine treatment[J]. Dement Geriatr Cogn Disord, 1997,8(2):78-84
[7] Guan ZZ, Zhang X, Ravid R , et al. Decreased protein levels of nicotinic receptor subunits in the hippocampus and temporal cortex of patients with Alzheimer's disease[J]. J Neurochem, 2000,74(1):237-243
[8] Qi XL, Xiu J, Shan KR , et al. Oxidative stress induced by beta-amyloid peptide(1-42) is involved in the altered composition of cellular membrane lipids and the decreased expression of nicotinic receptors in human SH-SY5Y neuroblastoma cells[J]. Neurochem Int, 2005,46(8):613-621
[9] 齐晓岚, 单可人, 肖雁 , 等. β-淀粉样肽对人SH-SY5Y神经细胞膜性脂质和胆碱能受体的影响[J]. 中华病理学杂志, 2006,35(1):37-41
Qi XL, Shan KR, Xiao Y . et al. Influence of β-amyloid peptide on cell membrane lipids and cholinergic receptors in human neuroblastoma SH-SY5Y cells[J]. Zhonghua Bing Li Xue Za Zhi, 2006,35(1):37-41
[10] Breese CR, Marks MJ, Logel J , et al. Effect of smoking history on [3H]nicotine binding in human postmortem brain[J]. J Pharmacol Exp Ther, 1997,282(1):7-13
[11] Marks MJ, Pauly JR, Gross SD , et al. Nicotine binding and nicotinic receptor subunit RNA after chronic nicotine treatment[J]. J Neurosci, 1992,12(7):2765-2784
doi: 10.1097/00005072-199207000-00009 pmid: 1613557
[1] Umesh Chandra Dash, Atish Kumar Sahoo. In vitro antioxidant assessment and a rapid HPTLC bioautographic method for the detection of anticholinesterase inhibitory activity of Geophila repens. Journal of Integrative Medicine, 2017, 15(3): 231-241.
[2] Lu Yu, Shui-miao Lin, Ru-qian Zhou, Wei-jun Tang, Pin-xian Huang, Ying Dong, Jian Wang, Zhi-hua Yu, Jiu-lin Chen, Li Wei, San-li Xing, Hui-juan Cao, Hong-bin Zhao. Chinese herbal medicine for patients with mild to moderate Alzheimer disease based on syndrome differentiation: A randomized controlled trial. Journal of Chinese Integrative Medicine, 2012, 10(7): 766-776.
[3] Ying-chun Miao , Jin-zhou Tian , Jing Shi , Min Mao. Effects of Chinese medicine for tonifying the kidney and resolving phlegm and blood stasis in treating patients with amnestic mild cognitive impairment: A randomized, double-blind and parallel-controlled trial. Journal of Chinese Integrative Medicine, 2012, 10(4): 390-397.
[4] Min Zhu , Mi Zhou , Ying Shi , Wen-wei Li. Effects of echinacoside on MPP+-induced mitochondrial fragmentation, mitophagy and cell apoptosis in SH-SY5Y cells. Journal of Chinese Integrative Medicine, 2012, 10(12): 1427-1432.
[5] Cai Lin-lin, Li Hao, Liu Jian-gang, Liu Long-tao, Guan Jie, Liu Ming-fang, Hu Jia, Wei Yun. Effects of early intervention with Huannao Yicong formula effective components on behavior and cholinergic system of β-amyloid precursor protein transgenic mice. Journal of Chinese Integrative Medicine, 2011, 9(3): 292-298.
[6] Yong-chang Diwu, Jin-zhou Tian, Jing Shi. Effects of Chinese herbal medicine Yinsiwei compound on spatial learning and memory ability and the ultrastructure of hippocampal neurons in a rat model of sporadic Alzheimer disease. Journal of Chinese Integrative Medicine, 2011, 9(2): 209-215.
[7] Li-bin Zhan , Xin-ping Niu, Hua Sui, Xiao-yang Gong. Protective effect of spleen-yin-nourishing recipe on amyloid β-peptide-induced damage of primarily cultured rat hippocampal neurons and its mechanism. Journal of Chinese Integrative Medicine, 2009, 7(3): 242-248.
[8] Min Cheng, Qiong Feng, Shu-wen Qian, Hui Gao, Cui-qing Zhu. Preliminary assay of p-amyloid binding elements in heart-beneficial recipe. Journal of Chinese Integrative Medicine, 2008, 6(1): 68-72.
[9] Rong-fang Ji, Jian-zhao Niu, Shu-qiang Xu, Jian Li, Ji-feng Wang, Jian-ping Liu. Treatment of Alzheimer disease: an evidence-based review. Journal of Chinese Integrative Medicine, 2007, 5(3): 247-254.
[10] Yong Tang, Hai-yan Yin, Fang Zeng, Shu-guang Yu. Pondering in-situ induction of endogenous neural stem cells in hippocampus of rats with Alzheimer disease by acupuncture. Journal of Chinese Integrative Medicine, 2005, 3(5): 351-354.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
[1] Jin-rong Fu. Establishment of multivariate diagnosis and treatment system of modern gynecology of traditional Chinese medicine. Journal of Chinese Integrative Medicine, 2008, 6(1): 22-24
[2] Hao Li, Ming-jiang Yao, Wen-ming Zhao, Jie Guan, Lin-lin Cai, Ling Cui. A randomized, controlled, double-blind trial of Huannao Yicong capsule in senile patients with mild cognitive impairment. Journal of Chinese Integrative Medicine, 2008, 6(1): 25-31
[3] Zhi-chun Jin. Problems in establishing clinical guideline for integrated traditional Chinese and Western medicine. Journal of Chinese Integrative Medicine, 2008, 6(1): 5-8
[4] SUN Ming-yu, ZUO Jian, DUAN Ji-feng, HAN Jun, FAN Shi-ming, ZHANG Wei, ZHU Li-fang, YAO Ming-hui. Antitumor activities of kushen flavonoids in vivo and in vitro. Journal of Chinese Integrative Medicine, 2008, 6(1): 51-59
[5] Min Cheng, Qiong Feng, Shu-wen Qian, Hui Gao, Cui-qing Zhu. Preliminary assay of p-amyloid binding elements in heart-beneficial recipe. Journal of Chinese Integrative Medicine, 2008, 6(1): 68-72
[6] Ning-qun Wang, Liang-duo Jiang, Zong-xing Li. Research progress in asthma-related quality of life. Journal of Chinese Integrative Medicine, 2008, 6(1): 93-97
[7] Jing-yuan Mao, Chang-xiao Liu, Heng-he Wang, Guang-li Wei , Zhen-peng Zhang, Jie Xing, Wang Xian liang , Ying-fei Bi . Effects of Shenmai Injection on serum concentration and pharmacokinetics of digoxin in dogs with heart failure. Journal of Chinese Integrative Medicine, 2010, 8(11): 1070-1074
[8] Zhi-mei Wang, Bin Zhang. A study on translation of ellipses in Huangdi Neijing from perspective of hermeneutic theory. Journal of Chinese Integrative Medicine, 2010, 8(11): 1097-1100
[9] Gui Yu, Jie Wang. Thinking on building the network cardiovasology of Chinese medicine. Journal of Chinese Integrative Medicine, 2012, 10(11): 1206-1210
[10] Pedro Saganha João, Doenitz Christoph, Greten Tobias, Efferth Thomas, J. Greten Henry. Qigong therapy for physiotherapists suffering from burnout: a preliminary study. Journal of Chinese Integrative Medicine, 2012, 10(11): 1233-1239
Journal of Integrative Medicine, ISSN: 2095-4964 CN 31-2083/R
Copyright © Journal of Integrative Medicine
Powered by Beijing Magtech Co. Ltd
沪公网安备31010602003416号      沪ICP备18017633号-3